Gene: Gm36550 (predicted gene, 36550) Mus musculus |
|
Analyze |
|
Symbol: |
Gm36550 |
Name: |
predicted gene, 36550 |
RGD ID: |
9670215 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 13 | 48,747,204 - 48,749,493 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 13 | 48,746,977 - 48,749,319 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 13 | 48,593,816 - 48,596,017 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 13 | 48,593,501 - 48,595,843 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 13 | 49,683,773 - 49,686,480 (+) | NCBI | | Celera | | | Cytogenetic Map | 13 | A5 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (GRCm39)
26884393 | Humsd7_m | humerus midshaft diameter 7, 16 week (mouse) | | | | | 13 | 3950000 | 76048119 | Mouse | 1558898 | Hpi1_m | hapatic PMN infiltration 1 (mouse) | | | Not determined | | 13 | 4414025 | 53101640 | Mouse | 1301880 | Hypt_m | hypertension (mouse) | | | Not determined | | 13 | 18156792 | 52156924 | Mouse | 13463469 | Gssq1_m | glomerulosclerosis severity QTL 1 (mouse) | | | | | 13 | 19060908 | 53061050 | Mouse | 12880423 | V25Dq7_m | vitamin D inactive form serum level QTL 7 (mouse) | | | | | 13 | 19583983 | 53583983 | Mouse | 1301015 | Sysbp2_m | systolic blood pressure 2 (mouse) | | | Not determined | | 13 | 20477612 | 59821605 | Mouse | 4142147 | Mvwf4_m | modifier of von Willebrand factor 4 (mouse) | | | Not determined | | | 20477612 | 112898424 | Mouse | 1357591 | Tesq1_m | testis weight QTL 1 (mouse) | | | Not determined | | 13 | 20615512 | 55720517 | Mouse | 4142009 | Pregq3_m | pregnancy QTL 3 (mouse) | | | Not determined | | 13 | 20615512 | 72385189 | Mouse | 10045618 | Heal17_m | wound healing/regeneration 17 (mouse) | | | Not determined | | 13 | 20746939 | 54747056 | Mouse | 4142489 | Ath25_m | atherosclerosis 25 (mouse) | | | Not determined | | | 25836529 | 59836529 | Mouse | 10401111 | Pgia40_m | proteoglycan induced arthritis 40 (mouse) | | | Not determined | | 13 | 27918469 | 61918560 | Mouse | 1300710 | Pcd4ts2_m | p-glycoprotein positive CD4 T cell subset 2 (mouse) | | | Not determined | | 13 | 28210442 | 62210544 | Mouse | 1357802 | Vtbt15_m | vertebral trabecular bone trait 15 (mouse) | | | Not determined | | 13 | 28217379 | 62217515 | Mouse | 10045621 | Heal21_m | wound healing/regeneration 21 (mouse) | | | Not determined | | 13 | 28217379 | 62217515 | Mouse | 10755533 | Chol18_m | cholesterol 18 (mouse) | | | | | 13 | 30969467 | 64969467 | Mouse | 10755517 | Chol15_m | cholesterol 15 (mouse) | | | | | 13 | 30969467 | 64969467 | Mouse | 12738439 | Twq4_m | testis weight QTL 4 (mouse) | | | | | 13 | 31129110 | 65129110 | Mouse | 14696729 | Kidlq2_m | kidney weight, left QTL 2 (mouse) | | | | | 13 | 31344736 | 65344736 | Mouse | 1301299 | Sluc23_m | susceptibility to lung cancer 23 (mouse) | | | Not determined | | 13 | 34921943 | 68922081 | Mouse | 10412235 | Scgq5_m | spontaneous crescentic glomerulonephritis QTL 5 (mouse) | | | Not determined | | 13 | 36060908 | 96239162 | Mouse | 1357587 | Pfat3_m | predicted fat percentage 3 (mouse) | | | Not determined | | 13 | 36101530 | 70101640 | Mouse | 1301734 | Acsns2_m | Angiostrongylus costaricensis nematode susceptibility 2 (mouse) | | | Not determined | | 13 | 36101530 | 70101640 | Mouse | 1300561 | Heal7_m | wound healing/regeneration 7 (mouse) | | | Not determined | | 13 | 36144820 | 70144904 | Mouse | 1300862 | Cfbw5_m | cystic fibrosis body weight 5 (mouse) | | | Not determined | | 13 | 38720358 | 72720517 | Mouse | 1300985 | Bmd13_m | bone mineral density 13 (mouse) | | | Not determined | | 13 | 39629249 | 73629397 | Mouse | 1302157 | Bwem2_m | body weight day 30 males 2 (mouse) | | | Not determined | | 13 | 39629249 | 73629397 | Mouse | 1301801 | Cpfd5_m | cerebellum pattern fissures (mouse) | | | Not determined | | 13 | 39629249 | 73629397 | Mouse | 15039353 | Nmrs35_m | NAFLD-associated magnetic resonance shift 35 (mouse) | | | | | 13 | 40588253 | 74588253 | Mouse | 1300668 | Pas10_m | pulmonary adenoma susceptibility 10 (mouse) | | | Not determined | | 13 | 41489042 | 75489158 | Mouse | 12738427 | Lfibq24_m | liver fibrosis QTL 24 (mouse) | | | | | 13 | 44258107 | 52758667 | Mouse | 4142331 | Bxs6_m | BXSB/MpJ autoimmune nephritis 6 (mouse) | | | Not determined | | | 45210442 | 83744746 | Mouse | 10412109 | Bxs7_m | BXSB/MpJ autoimmune nephritis 7 (mouse) | | | Not determined | | 13 | 45210442 | 83744746 | Mouse | 26884396 | Humsd4_m | humerus midshaft diameter 4, 10 week (mouse) | | | | | 13 | 47853476 | 73148119 | Mouse | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000221947 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 13 | 48,746,977 - 48,749,319 (+) | Ensembl | GRCm38.p6 Ensembl | 13 | 48,593,501 - 48,595,843 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_001780934 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 13 | 48,747,204 - 48,749,493 (+) | NCBI | GRCm38 | 13 | 48,593,816 - 48,596,017 (+) | NCBI |
|
Sequence: |
TTGTGCTTTTCATAGCCGGTCCTCAGGTGTTTTAAAAGAAAGTCCTTCTACTTTTCTTTGGAAA AGGATAGAATAAAAAGTTTATCATAATACAGAGGTCTATGCTAGATCCTACAATATTATTAAAG GATTATTCGATATCTCAGAGCTACCACCTTCCTCTCTTTTCTTGATAGAAATATTTGAATGGAA CAAATAAAGACATTTTAGAGCTAAGAAGTCGTTTCTGTTTTGTACTTTCAGAGGTGGAAACCTG ACTCTTGGTTATACGCTGCTGGGAGCAACTTCGTTGTGAGAGAATAACTACGACCAGGCATGCC TTCCCAAAGTTCAAAACTGAAACAGCCCTTGCTGAAACCCTGAACTCAGAAGAAAATGCCCAGT TACTGGAGTACAGGGCCTGCCTGGGATGCTTGGGATTTGAGCCACCTCCTGGAACAATCAAAGA GGAAAAGCCAAGGATGCACTTGGTACCTGCTGGACTGGCTTGTTTTCCTGTGCTCACCAAGAGA ATGTATAATTTTGCATTTTGTATAAGATACCTCATTTTTCTCTTGAAGTATTACTCTAAGCTTG GTTCTGCCCAGCTGCAAACAGGCAGTGGCTACAAGAGCCGTTAGCTCAGACCCTGGCCAGCTCC ACACTCTTCTGCAGTGGCTGTGGGAGAGGCCCAAGTAGCGTGTTTGGAAGTGGAGAGAGGAGAG AGATGGAGCATAGTGTCCTGTGCTTTGTGTTCACAAAGTAAAGGAGACTGAACACTC
hide sequence
|
Additional Information
|
|