Gene: Gm5116 (predicted gene 5116) Mus musculus |
|
Analyze |
|
Symbol: |
Gm5116 |
Name: |
predicted gene 5116 |
RGD ID: |
1620447 |
MGI Page |
MGI |
Description: |
|
Type: |
protein-coding (Ensembl: processed_pseudogene)
|
RefSeq Status: |
MODEL |
Previously known as: |
60S ribosomal protein L23a pseudogene; 60S ribosomal protein L23a-like; EG330689 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 7 | 32,195,063 - 32,195,530 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 7 | 32,195,063 - 32,195,525 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 7 | 32,495,638 - 32,496,105 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 7 | 32,495,638 - 32,496,100 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 7 | 33,280,657 - 33,281,124 (+) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | MGSCv37 | 7 | 33,280,657 - 33,281,124 (+) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | MGSCv36 | 7 | 32,204,398 - 32,204,865 (+) | NCBI | | MGSCv36 | mm8 | | Celera | 7 | 26,404,288 - 26,404,755 (+) | NCBI | | Celera | | | Cytogenetic Map | 7 | B1 | NCBI | | | | | cM Map | 7 | 19.34 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (GRCm39)
1301572 | Sluc30_m | susceptibility to lung cancer 30 (mouse) | | | Not determined | | 7 | 2431696 | 36431844 | Mouse | 1300722 | Sle3_m | systemic lupus erythmatosus susceptibility 3 (mouse) | | | Not determined | | 7 | 3511728 | 87142720 | Mouse | 38501068 | Tip1_m | tuberculosis immunophenotype 1, spleen CFU (mouse) | | | | | 7 | 3602999 | 72549748 | Mouse | 25314307 | Mlh1fc2_m | MLH1 foci count 2 (mouse) | | | | | 7 | 6502999 | 133501729 | Mouse | 12792978 | Fbmd3_m | femoral bone mineral density 3, females only (mouse) | | | | | 7 | 7050288 | 142367832 | Mouse | 1357699 | Nhdlq6_m | non-HDL QTL 6 (mouse) | | | Not determined | | 7 | 9988867 | 43988984 | Mouse | 1558893 | Spir1_m | Streptococcus pneumoniae infection resistance 1 (mouse) | | | Not determined | | 7 | 10305798 | 44305936 | Mouse | 10449139 | Eosn1_m | eosinophil differential 1 (mouse) | | | | | 7 | 12480877 | 46480877 | Mouse | 10449158 | Eosn3_m | eosinophil differential 3 (mouse) | | | | | 7 | 12480877 | 46480877 | Mouse | 4141566 | Femwf8_m | femur work to failure 8 (mouse) | | | Not determined | | | 13032485 | 47032621 | Mouse | 11522751 | Cocia17_m | cocaine-induced activity, QTL 17 (mouse) | | | | | 7 | 13135204 | 47135204 | Mouse | 25314314 | Sccor1_m | synaptonemal complex length to mean MLH1 count ratio 1 (mouse) | | | | | 7 | 13333925 | 47349748 | Mouse | 1559016 | Drsi_m | DCC-related Spp1 induction (mouse) | | | Not determined | | 7 | 16637293 | 49159331 | Mouse | 1301041 | Prnr2_m | prion resistance 2 (mouse) | | | Not determined | | 7 | 18728794 | 39674033 | Mouse | 10412199 | Sst2_m | susceptibility to tuberculosis 2 (mouse) | | | Not determined | | 7 | 18728794 | 119485380 | Mouse | 1301158 | Eae4_m | susceptibility to experimental allergic encephalomyelitis 4 (mouse) | | | Not determined | | 7 | 19147398 | 141919804 | Mouse | 1301622 | Eae12_m | susceptibility to experimental allergic encephalomyelitis 12 (mouse) | | | Not determined | | 7 | 19280015 | 53280104 | Mouse | 1301052 | Bhr6_m | bronchial hyperresponsiveness 6 (mouse) | | | Not determined | | 7 | 19842250 | 53842367 | Mouse | 12904742 | Litsq2_m | litter size QTL 2 (mouse) | | | | | 7 | 22673887 | 56674033 | Mouse | 1301709 | Bdt4_m | bone density traits 4 (mouse) | | | Not determined | | 7 | 22888572 | 56888716 | Mouse | 11354952 | Pdcc1_m | plasmacytoid dentritic cell compartment 1 (mouse) | | | | | 7 | 23066531 | 57066531 | Mouse | 1301969 | Lbw5_m | lupus NZB x NZW 5 (mouse) | | | Not determined | | 7 | 26847615 | 60851775 | Mouse | 7394747 | asp3_m | audiogenic seizure prone 3 (mouse) | | | Not determined | | 7 | 27305798 | 36842367 | Mouse | 12790989 | Tgl6_m | triglyceride 6 (mouse) | | | | | 7 | 27540549 | 61540549 | Mouse | 4141805 | Sle19_m | systematic lupus erythematosus susceptibility 19 (mouse) | | | Not determined | | | 30032485 | 81135653 | Mouse | 26884404 | Huml1_m | humerus length 1, 5 week (mouse) | | | | | 7 | 30199425 | 108999207 | Mouse | 1301175 | Ap7q_m | alcohol preference 7 QTL (mouse) | | | Not determined | | 7 | 31714845 | 65715077 | Mouse | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000187732 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 7 | 32,195,063 - 32,195,525 (+) | Ensembl | GRCm38.p6 Ensembl | 7 | 32,495,638 - 32,496,100 (+) | Ensembl |
|
RefSeq Acc Id: |
XM_036153631 ⟹ XP_036009524 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 7 | 32,195,063 - 32,195,530 (+) | NCBI |
|
Sequence: |
ATGGCACCAAAAGCGAAGAAGGAAGCCTTGGCCCTTCCCAAAGATGAAGCCAAAGCAAAGGCCT TGAAAGCTAAGAAGGCAGTGCTGAAAGGCATCCACACCCACAAAAAGAAGATCAGAACATCACC CACTTTCTGGAAGCCCAAGTCCCTGTGGCTCCAGAGTAAGTCAAAATATCCTCAAAATAGTGAG CCCAGGAGAAACAAGCTTGACCACTATGTTATCATCAAATTGCCACTGACCACGAATTTAGCCA TGAAGAAAATAAAGGATAAAAACACGCTTGTGTTCATTGTGGATGTCAATACCAACAAGCACCA GATCAAAGAGGCCATGAAGAAACTCGATGACATTGATGTGACCAAAGTCCGTACCCTAACAAGG CCTGACAGAGAGAAGAAGGCATATGTTTGCTTAGCTCCTGATTATGATGCTCTGGATGTTGCCA ACAAGATTAGGGTGATCTAA
hide sequence
|
RefSeq Acc Id: |
XP_036009524 ⟸ XM_036153631 |
Additional Information
|
|