Gene: Gm25296 (predicted gene, 25296) Mus musculus |
|
Analyze |
|
Symbol: |
Gm25296 |
Name: |
predicted gene, 25296 |
RGD ID: |
15554211 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC115485831; small nucleolar RNA SNORD95 |
RGD Orthologs |
|
Alliance Genes |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 Ensembl - Mouse Genome Assembly GRCm39 Ensembl |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 11 | 48,691,692 - 48,691,759 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 11 | 48,691,693 - 48,691,759 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 11 | 48,800,865 - 48,800,932 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 11 | 48,800,866 - 48,800,932 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 11 | B1.2 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
Comparative Map Data
Gm25296 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 11 | 48,691,692 - 48,691,759 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 11 | 48,691,693 - 48,691,759 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 11 | 48,800,865 - 48,800,932 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 11 | 48,800,866 - 48,800,932 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 11 | B1.2 | NCBI | | | | |
|
LOC124900283 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 9 | 81,888,918 - 81,888,985 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 9 | 81,888,918 - 81,888,985 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | Cytogenetic Map | 9 | q21.32 | NCBI | | | | | T2T-CHM13v2.0 | 9 | 94,038,544 - 94,038,611 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
miRNA Target Status
Predicted Target Of
Count of predictions: | 140 | Count of miRNA genes: | 137 | Interacting mature miRNAs: | 138 | Transcripts: | ENSMUST00000082566 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000082566 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 11 | 48,691,693 - 48,691,759 (+) | Ensembl | GRCm38.p6 Ensembl | 11 | 48,800,866 - 48,800,932 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004937323 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 11 | 48,691,692 - 48,691,759 (+) | NCBI |
|
Sequence: |
GGAGCAATGATGACCCCAACATGCCATCTGAGTGGCTTTGCTGAAATCCAGAGGCTGTTTCTGA GCTG
hide sequence
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2020-07-02 |
Gm25296 |
predicted gene, 25296 |
LOC115485831 |
small nucleolar RNA SNORD95 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-30 |
LOC115485831 |
small nucleolar RNA SNORD95 |
Gm25296 |
predicted gene, 25296 |
Symbol and/or name change |
5135510 |
APPROVED |
2020-06-25 |
Gm25296 |
predicted gene, 25296 |
LOC115485831 |
small nucleolar RNA SNORD95 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-19 |
LOC115485831 |
small nucleolar RNA SNORD95 |
Gm25296 |
predicted gene, 25296 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|