Gene: Gm26447 (predicted gene, 26447) Mus musculus |
|
Analyze |
|
Symbol: |
Gm26447 |
Name: |
predicted gene, 26447 |
RGD ID: |
15554200 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
Previously known as: |
LOC115488689; small nucleolar RNA SNORA63 |
RGD Orthologs |
|
Alliance Genes |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 Ensembl - Mouse Genome Assembly GRCm39 Ensembl |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 16 | 22,930,051 - 22,930,179 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 16 | 22,930,051 - 22,930,179 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 16 | 23,111,301 - 23,111,429 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 16 | 23,111,301 - 23,111,429 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 16 | B1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
Comparative Map Data
Gm26447 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 16 | 22,930,051 - 22,930,179 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 16 | 22,930,051 - 22,930,179 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 16 | 23,111,301 - 23,111,429 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 16 | 23,111,301 - 23,111,429 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 16 | B1 | NCBI | | | | |
|
SNORA63C (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 1 | 36,418,448 - 36,418,578 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 1 | 36,418,450 - 36,418,578 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 1 | 36,884,049 - 36,884,179 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Cytogenetic Map | 1 | p34.3 | NCBI | | | | | T2T-CHM13v2.0 | 1 | 36,281,308 - 36,281,438 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
LOC119873477 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 9 | 51,517,131 - 51,517,256 (-) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 9 | 53,145,614 - 53,145,739 (-) | NCBI | | ROS_Cfam_1.0 | | | ROS_Cfam_1.0 Ensembl | 9 | 53,145,614 - 53,145,739 (-) | Ensembl | | ROS_Cfam_1.0 Ensembl | | | UMICH_Zoey_3.1 | 9 | 51,925,337 - 51,925,462 (-) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 9 | 52,250,195 - 52,250,320 (-) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 9 | 52,336,149 - 52,336,274 (-) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
miRNA Target Status
Predicted Target Of
Count of predictions: | 40 | Count of miRNA genes: | 36 | Interacting mature miRNAs: | 40 | Transcripts: | ENSMUST00000082448 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000082448 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 16 | 22,930,051 - 22,930,179 (+) | Ensembl | GRCm38.p6 Ensembl | 16 | 23,111,301 - 23,111,429 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004939376 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 16 | 22,930,051 - 22,930,179 (+) | NCBI |
|
Sequence: |
AAGCAGGATTTAACTACAATATAGCTGCTCAGTGCTGTGTTGTCGTTCCCCCTGCTCAGAATAA TTGTTTCTTAACTATACCTGTCTGCCATCTGCCTGTAGCAGCCAGGGACGCTTGGTCTCAAACA T
hide sequence
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2020-07-02 |
Gm26447 |
predicted gene, 26447 |
LOC115488689 |
small nucleolar RNA SNORA63 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-30 |
LOC115488689 |
small nucleolar RNA SNORA63 |
Gm26447 |
predicted gene, 26447 |
Symbol and/or name change |
5135510 |
APPROVED |
2020-06-25 |
Gm26447 |
predicted gene, 26447 |
LOC115488689 |
small nucleolar RNA SNORA63 |
Symbol and/or name change |
19259462 |
PROVISIONAL |
2020-06-19 |
LOC115488689 |
small nucleolar RNA SNORA63 |
Gm26447 |
predicted gene, 26447 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|