NM_001142864.4(PIEZO1):c.5544C>T (p.Val1848=) |
single nucleotide variant |
PIEZO1-related condition [RCV003925820]|not provided [RCV000936447] |
Chr16:88721290 [GRCh38] Chr16:88787698 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4601G>A (p.Arg1534Gln) |
single nucleotide variant |
not provided [RCV000523522] |
Chr16:88722904 [GRCh38] Chr16:88789312 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1264C>T (p.Gln422Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001029734]|not provided [RCV000519722] |
Chr16:88736671 [GRCh38] Chr16:88803079 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.4(PIEZO1):c.1558-10C>T |
single nucleotide variant |
not provided [RCV001507367] |
Chr16:88735256 [GRCh38] Chr16:88801664 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2791-24C>A |
single nucleotide variant |
not provided [RCV001507359] |
Chr16:88732559 [GRCh38] Chr16:88798967 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2176C>T (p.His726Tyr) |
single nucleotide variant |
PIEZO1-related condition [RCV003900752]|not provided [RCV001507364] |
Chr16:88734360 [GRCh38] Chr16:88800768 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1126C>G (p.Pro376Ala) |
single nucleotide variant |
Familial hemolytic anemia [RCV000655923] |
Chr16:88737628 [GRCh38] Chr16:88804036 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6674T>G (p.Met2225Arg) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049231] |
Chr16:88716885 [GRCh38] Chr16:88783293 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7367G>A (p.Arg2456His) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049232]|not provided [RCV001388579] |
Chr16:88715804 [GRCh38] Chr16:88782212 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6058G>A (p.Ala2020Thr) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049233]|not provided [RCV000224939] |
Chr16:88720175 [GRCh38] Chr16:88786583 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.4(PIEZO1):c.4073G>C (p.Arg1358Pro) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049234] |
Chr16:88725505 [GRCh38] Chr16:88791913 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6380C>T (p.Thr2127Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049236]|not provided [RCV001781379] |
Chr16:88719665 [GRCh38] Chr16:88786073 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.3(PIEZO1):c.7479_7484dupGGAGCT (p.Glu2496_Glu2497insLeuGlu) |
duplication |
Xerocytosis [RCV000049237] |
Chr16:88715687..88715692 [GRCh38] Chr16:88782095..88782100 [GRCh37] Chr16:16q24.3 |
pathogenic |
GRCh38/hg38 16q23.1-24.3(chr16:78816291-90081985)x3 |
copy number gain |
See cases [RCV000050840] |
Chr16:78816291..90081985 [GRCh38] Chr16:78850188..90148393 [GRCh37] Chr16:77407689..88675894 [NCBI36] Chr16:16q23.1-24.3 |
pathogenic |
GRCh38/hg38 16q22.1-24.3(chr16:70514631-90081985)x3 |
copy number gain |
See cases [RCV000052422] |
Chr16:70514631..90081985 [GRCh38] Chr16:70548534..90148393 [GRCh37] Chr16:69106035..88675894 [NCBI36] Chr16:16q22.1-24.3 |
pathogenic |
GRCh38/hg38 16q21-24.3(chr16:65313395-90081985)x3 |
copy number gain |
See cases [RCV000052421] |
Chr16:65313395..90081985 [GRCh38] Chr16:65347298..90148393 [GRCh37] Chr16:63904799..88675894 [NCBI36] Chr16:16q21-24.3 |
pathogenic |
GRCh38/hg38 16q23.1-24.3(chr16:76873569-90081985)x3 |
copy number gain |
See cases [RCV000052423] |
Chr16:76873569..90081985 [GRCh38] Chr16:76907466..90148393 [GRCh37] Chr16:75464967..88675894 [NCBI36] Chr16:16q23.1-24.3 |
pathogenic |
GRCh38/hg38 16q23.3-24.3(chr16:82173150-90081985)x3 |
copy number gain |
See cases [RCV000052424] |
Chr16:82173150..90081985 [GRCh38] Chr16:82206755..90148393 [GRCh37] Chr16:80764256..88675894 [NCBI36] Chr16:16q23.3-24.3 |
pathogenic |
GRCh38/hg38 16q24.1-24.3(chr16:84707538-90081985)x3 |
copy number gain |
Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052425]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052425]|See cases [RCV000052425] |
Chr16:84707538..90081985 [GRCh38] Chr16:84741144..90148393 [GRCh37] Chr16:83298645..88675894 [NCBI36] Chr16:16q24.1-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:87853401-90081985)x3 |
copy number gain |
See cases [RCV000052428] |
Chr16:87853401..90081985 [GRCh38] Chr16:87887007..90148393 [GRCh37] Chr16:86444508..88675894 [NCBI36] Chr16:16q24.2-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:88640116-89530475)x1 |
copy number loss |
See cases [RCV000053380] |
Chr16:88640116..89530475 [GRCh38] Chr16:88706524..89596883 [GRCh37] Chr16:87234025..88124384 [NCBI36] Chr16:16q24.2-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:88662702-89454555)x1 |
copy number loss |
See cases [RCV000053381] |
Chr16:88662702..89454555 [GRCh38] Chr16:88729110..89520963 [GRCh37] Chr16:87256611..88048464 [NCBI36] Chr16:16q24.2-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:87306529-89269079)x1 |
copy number loss |
See cases [RCV000053362] |
Chr16:87306529..89269079 [GRCh38] Chr16:87340135..89335487 [GRCh37] Chr16:85897636..87862988 [NCBI36] Chr16:16q24.2-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:88159660-89506042)x1 |
copy number loss |
See cases [RCV000053363] |
Chr16:88159660..89506042 [GRCh38] Chr16:88193266..89572450 [GRCh37] Chr16:86750767..88099951 [NCBI36] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.2(PIEZO1):c.3938A>C (p.Asp1313Ala) |
single nucleotide variant |
Malignant melanoma [RCV000071269] |
Chr16:88726314 [GRCh38] Chr16:88792722 [GRCh37] Chr16:87320223 [NCBI36] Chr16:16q24.3 |
not provided |
NM_001142864.2(PIEZO1):c.3937G>T (p.Asp1313Tyr) |
single nucleotide variant |
Malignant melanoma [RCV000071270] |
Chr16:88726315 [GRCh38] Chr16:88792723 [GRCh37] Chr16:87320224 [NCBI36] Chr16:16q24.3 |
not provided |
PIEZO1, E756DEL |
deletion |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000664183] |
Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3107G>A (p.Arg1036His) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000661912]|Inborn genetic diseases [RCV002530589]|Lymphatic malformation 6 [RCV000661913]|not provided [RCV002227195] |
Chr16:88731795 [GRCh38] Chr16:88798203 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001012759.1(CTU2):c.804C>T (p.Cys268=) |
single nucleotide variant |
Malignant melanoma [RCV000071268] |
Chr16:88713378 [GRCh38] Chr16:88779786 [GRCh37] Chr16:87307287 [NCBI36] Chr16:16q24.3 |
not provided |
NM_001142864.4(PIEZO1):c.2159G>A (p.Arg720His) |
single nucleotide variant |
not provided [RCV001638053] |
Chr16:88734377 [GRCh38] Chr16:88800785 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5619T>C (p.Phe1873=) |
single nucleotide variant |
not provided [RCV001812991] |
Chr16:88721215 [GRCh38] Chr16:88787623 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2329+19G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788449]|Lymphatic malformation 6 [RCV001788450]|not provided [RCV001619899] |
Chr16:88733887 [GRCh38] Chr16:88800295 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4274G>A (p.Ser1425Asn) |
single nucleotide variant |
PIEZO1-related condition [RCV003908496]|not provided [RCV001812305] |
Chr16:88723932 [GRCh38] Chr16:88790340 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1797C>G (p.Val599=) |
single nucleotide variant |
not provided [RCV001507366] |
Chr16:88734926 [GRCh38] Chr16:88801334 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.19G>C (p.Gly7Arg) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001331712] |
Chr16:88784946 [GRCh38] Chr16:88851354 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5743C>G (p.Arg1915Gly) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001331714] |
Chr16:88720674 [GRCh38] Chr16:88787082 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6661-12T>G |
single nucleotide variant |
not provided [RCV001812420] |
Chr16:88716910 [GRCh38] Chr16:88783318 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1365G>A (p.Thr455=) |
single nucleotide variant |
not provided [RCV001685346]|not specified [RCV001796419] |
Chr16:88736340 [GRCh38] Chr16:88802748 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7006C>T (p.Arg2336Trp) |
single nucleotide variant |
not provided [RCV001751546] |
Chr16:88716404 [GRCh38] Chr16:88782812 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.910_912del (p.Leu304del) |
deletion |
not provided [RCV001810582] |
Chr16:88738042..88738044 [GRCh38] Chr16:88804450..88804452 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5004G>A (p.Gly1668=) |
single nucleotide variant |
not provided [RCV000597189] |
Chr16:88722018 [GRCh38] Chr16:88788426 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4235-233G>A |
single nucleotide variant |
not provided [RCV001564784] |
Chr16:88724204 [GRCh38] Chr16:88790612 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2401C>T (p.Arg801Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004035719]|Lymphatic malformation 6 [RCV001331713] |
Chr16:88733674 [GRCh38] Chr16:88800082 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh38/hg38 16q23.3-24.3(chr16:83988570-90081985)x3 |
copy number gain |
See cases [RCV000135659] |
Chr16:83988570..90081985 [GRCh38] Chr16:84022175..90148393 [GRCh37] Chr16:82579676..88675894 [NCBI36] Chr16:16q23.3-24.3 |
likely pathogenic |
GRCh38/hg38 16q23.2-24.3(chr16:80946659-90081985)x3 |
copy number gain |
See cases [RCV000136898] |
Chr16:80946659..90081985 [GRCh38] Chr16:80980556..90148393 [GRCh37] Chr16:79538057..88675894 [NCBI36] Chr16:16q23.2-24.3 |
pathogenic|likely pathogenic |
GRCh38/hg38 16q22.1-24.3(chr16:70749398-90096995)x3 |
copy number gain |
See cases [RCV000137495] |
Chr16:70749398..90096995 [GRCh38] Chr16:70783301..90163403 [GRCh37] Chr16:69340802..88690904 [NCBI36] Chr16:16q22.1-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:87848216-90096995)x3 |
copy number gain |
See cases [RCV000138161] |
Chr16:87848216..90096995 [GRCh38] Chr16:87881822..90163403 [GRCh37] Chr16:86439323..88690904 [NCBI36] Chr16:16q24.2-24.3 |
likely pathogenic |
GRCh38/hg38 16q23.3-24.3(chr16:83478453-89932910)x3 |
copy number gain |
See cases [RCV000137980] |
Chr16:83478453..89932910 [GRCh38] Chr16:83512058..89999318 [GRCh37] Chr16:82069559..88526819 [NCBI36] Chr16:16q23.3-24.3 |
likely pathogenic |
GRCh38/hg38 16q21-24.3(chr16:65511483-90096995)x3 |
copy number gain |
See cases [RCV000139426] |
Chr16:65511483..90096995 [GRCh38] Chr16:65545386..90163403 [GRCh37] Chr16:64102887..88690904 [NCBI36] Chr16:16q21-24.3 |
pathogenic |
GRCh38/hg38 16q23.1-24.3(chr16:75377981-90081992)x3 |
copy number gain |
See cases [RCV000139302] |
Chr16:75377981..90081992 [GRCh38] Chr16:75411879..90148400 [GRCh37] Chr16:73969380..88675901 [NCBI36] Chr16:16q23.1-24.3 |
pathogenic |
GRCh38/hg38 16q24.2-24.3(chr16:88662702-88719577)x1 |
copy number loss |
See cases [RCV000140351] |
Chr16:88662702..88719577 [GRCh38] Chr16:88729110..88785985 [GRCh37] Chr16:87256611..87313486 [NCBI36] Chr16:16q24.2-24.3 |
benign |
GRCh38/hg38 16q24.1-24.3(chr16:85552976-90096995)x3 |
copy number gain |
See cases [RCV000139658] |
Chr16:85552976..90096995 [GRCh38] Chr16:85586582..90163403 [GRCh37] Chr16:84144083..88690904 [NCBI36] Chr16:16q24.1-24.3 |
pathogenic |
GRCh38/hg38 16q23.2-24.3(chr16:80717291-90096662)x3 |
copy number gain |
See cases [RCV000141128] |
Chr16:80717291..90096662 [GRCh38] Chr16:80751188..90163070 [GRCh37] Chr16:79308689..88690571 [NCBI36] Chr16:16q23.2-24.3 |
pathogenic |
GRCh38/hg38 16q23.1-24.3(chr16:76336203-90088654)x3 |
copy number gain |
See cases [RCV000141700] |
Chr16:76336203..90088654 [GRCh38] Chr16:76370100..90155062 [GRCh37] Chr16:74927601..88682563 [NCBI36] Chr16:16q23.1-24.3 |
pathogenic |
GRCh38/hg38 16q21-24.3(chr16:64389378-90081985)x3 |
copy number gain |
See cases [RCV000142578] |
Chr16:64389378..90081985 [GRCh38] Chr16:64423281..90148393 [GRCh37] Chr16:62980782..88675894 [NCBI36] Chr16:16q21-24.3 |
pathogenic|likely pathogenic |
GRCh38/hg38 16q23.2-24.3(chr16:80067315-90057871)x3 |
copy number gain |
See cases [RCV000142698] |
Chr16:80067315..90057871 [GRCh38] Chr16:80101212..90124279 [GRCh37] Chr16:78658713..88651780 [NCBI36] Chr16:16q23.2-24.3 |
pathogenic |
GRCh38/hg38 16q12.2-24.3(chr16:52899183-90088654)x3 |
copy number gain |
See cases [RCV000143425] |
Chr16:52899183..90088654 [GRCh38] Chr16:52933095..90155062 [GRCh37] Chr16:51490596..88682563 [NCBI36] Chr16:16q12.2-24.3 |
pathogenic |
GRCh38/hg38 16q24.1-24.3(chr16:86950106-89335814)x1 |
copy number loss |
See cases [RCV000143624] |
Chr16:86950106..89335814 [GRCh38] Chr16:86983712..89402222 [GRCh37] Chr16:85541213..87929723 [NCBI36] Chr16:16q24.1-24.3 |
pathogenic |
GRCh37/hg19 16q23.1-24.3(chr16:74872514-90274440)x3 |
copy number gain |
See cases [RCV000240108] |
Chr16:74872514..90274440 [GRCh37] Chr16:16q23.1-24.3 |
pathogenic |
t(5;16)(p15.31;q23.1) |
translocation |
not provided [RCV000203391] |
Chr5:1..8180513 [GRCh37] Chr16:76935310..90354753 [GRCh37] Chr5:5p15.33-15.31 Chr16:16q23.1-24.3 |
likely pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258442] |
Chr16:88556191..89557911 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258457] |
Chr16:88630607..89607742 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258180] |
Chr16:88230961..89363602 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258201] |
Chr16:88666177..89472627 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258213] |
Chr16:88165980..88914268 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258230] |
Chr16:87183661..89520803 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258283] |
Chr16:88643461..89611494 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258300] |
Chr16:88755312..89584412 [GRCh37] Chr16:16q24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258311] |
Chr16:88230760..89363742 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
16q24.3 microdeletion syndrome [RCV000258380] |
Chr16:87340135..89335428 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
GRCh37/hg19 16q11.2-24.3(chr16:46615804-90142285)x1 |
copy number loss |
Breast ductal adenocarcinoma [RCV000207138] |
Chr16:46615804..90142285 [GRCh37] Chr16:16q11.2-24.3 |
uncertain significance |
GRCh37/hg19 16q22.2-24.3(chr16:72107834-90142285)x1 |
copy number loss |
Breast ductal adenocarcinoma [RCV000207182] |
Chr16:72107834..90142285 [GRCh37] Chr16:16q22.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6479C>T (p.Pro2160Leu) |
single nucleotide variant |
not provided [RCV000756481] |
Chr16:88717204 [GRCh38] Chr16:88783612 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1370G>A (p.Arg457His) |
single nucleotide variant |
Inborn genetic diseases [RCV003243291]|PIEZO1-related condition [RCV003965561]|not provided [RCV000756478] |
Chr16:88736335 [GRCh38] Chr16:88802743 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.3050T>C (p.Leu1017Pro) |
single nucleotide variant |
not provided [RCV000756486] |
Chr16:88731852 [GRCh38] Chr16:88798260 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2865G>A (p.Gln955=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788342]|Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002507323]|Lymphatic malformation 6 [RCV001788343]|PIEZO1-related condition [RCV003918236]|not provided [RCV001573930] |
Chr16:88732461 [GRCh38] Chr16:88798869 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4499G>A (p.Arg1500Gln) |
single nucleotide variant |
not provided [RCV000756482] |
Chr16:88723006 [GRCh38] Chr16:88789414 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5552C>T (p.Thr1851Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002493375]|not provided [RCV000756485] |
Chr16:88721282 [GRCh38] Chr16:88787690 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4888G>T (p.Glu1630Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208750] |
Chr16:88722285 [GRCh38] Chr16:88788693 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6682C>T (p.Gln2228Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208759] |
Chr16:88716877 [GRCh38] Chr16:88783285 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.1669+1G>A |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208762] |
Chr16:88735134 [GRCh38] Chr16:88801542 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3796+1G>A |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208768]|not provided [RCV003736641] |
Chr16:88726546 [GRCh38] Chr16:88792954 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2263G>T (p.Glu755Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208769] |
Chr16:88733972 [GRCh38] Chr16:88800380 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7289C>T (p.Pro2430Leu) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208773] |
Chr16:88715960 [GRCh38] Chr16:88782368 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6511G>T (p.Val2171Phe) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000208749] |
Chr16:88717172 [GRCh38] Chr16:88783580 [GRCh37] Chr16:16q24.3 |
pathogenic |
Single allele |
complex |
Breast ductal adenocarcinoma [RCV000207314] |
Chr16:56368689..90141355 [GRCh37] Chr16:16q12.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2344G>A (p.Gly782Ser) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000989648]|PIEZO1-related condition [RCV003977698]|not provided [RCV000756474]|not specified [RCV003320464] |
Chr16:88733731 [GRCh38] Chr16:88800139 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2409G>C (p.Gln803His) |
single nucleotide variant |
PIEZO1-related condition [RCV003965562]|not provided [RCV001811463] |
Chr16:88733666 [GRCh38] Chr16:88800074 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1270T>C (p.Tyr424His) |
single nucleotide variant |
PIEZO1-related condition [RCV003930019]|not provided [RCV001812665]|not specified [RCV000238715] |
Chr16:88736665 [GRCh38] Chr16:88803073 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5743C>A (p.Arg1915Ser) |
single nucleotide variant |
not provided [RCV000895429]|not specified [RCV000238978] |
Chr16:88720674 [GRCh38] Chr16:88787082 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
GRCh37/hg19 16q24.2-24.3(chr16:87687199-89304429)x3 |
copy number gain |
See cases [RCV000240062] |
Chr16:87687199..89304429 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1024_1028delinsGAGGC (p.Lys342_Glu343delinsGluAla) |
indel |
not specified [RCV000522301] |
Chr16:88737807..88737811 [GRCh38] Chr16:88804215..88804219 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.3(chr16:88825321-88860473)x3 |
copy number gain |
See cases [RCV000240336] |
Chr16:88825321..88860473 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88601532-89713753)x3 |
copy number gain |
See cases [RCV000240352] |
Chr16:88601532..89713753 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6079G>A (p.Val2027Met) |
single nucleotide variant |
not provided [RCV000520777] |
Chr16:88720154 [GRCh38] Chr16:88786562 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2035G>T (p.Glu679Ter) |
single nucleotide variant |
not provided [RCV000301777] |
Chr16:88734501 [GRCh38] Chr16:88800909 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4297C>A (p.Pro1433Thr) |
single nucleotide variant |
not provided [RCV002283038] |
Chr16:88723909 [GRCh38] Chr16:88790317 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7550C>G (p.Thr2517Ser) |
single nucleotide variant |
not provided [RCV001573075] |
Chr16:88715621 [GRCh38] Chr16:88782029 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3029G>A (p.Arg1010His) |
single nucleotide variant |
not provided [RCV003491360]|not specified [RCV003320510] |
Chr16:88731873 [GRCh38] Chr16:88798281 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2209C>A (p.Leu737Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001270740]|not provided [RCV003235530] |
Chr16:88734026 [GRCh38] Chr16:88800434 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3181C>G (p.Pro1061Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV002527039]|not provided [RCV000490090]|not specified [RCV002465688] |
Chr16:88731721 [GRCh38] Chr16:88798129 [GRCh37] Chr16:16q24.3 |
likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6854G>A (p.Arg2285His) |
single nucleotide variant |
Inborn genetic diseases [RCV003244673] |
Chr16:88716631 [GRCh38] Chr16:88783039 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6969G>C (p.Lys2323Asn) |
single nucleotide variant |
not provided [RCV001760645] |
Chr16:88716441 [GRCh38] Chr16:88782849 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2233CAG[4] (p.Gln749del) |
microsatellite |
not provided [RCV001692283] |
Chr16:88733988..88733990 [GRCh38] Chr16:88800396..88800398 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5121G>C (p.Ser1707=) |
single nucleotide variant |
not provided [RCV000757606]|not specified [RCV001573923] |
Chr16:88721901 [GRCh38] Chr16:88788309 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5838C>T (p.Phe1946=) |
single nucleotide variant |
not provided [RCV000757607] |
Chr16:88720496 [GRCh38] Chr16:88786904 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6678C>T (p.Ser2226=) |
single nucleotide variant |
not provided [RCV001644797]|not specified [RCV001573344] |
Chr16:88716881 [GRCh38] Chr16:88783289 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4754A>G (p.Asn1585Ser) |
single nucleotide variant |
not provided [RCV000757609] |
Chr16:88722604 [GRCh38] Chr16:88789012 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7529C>T (p.Pro2510Leu) |
single nucleotide variant |
not provided [RCV000757610]|not specified [RCV003320210] |
Chr16:88715642 [GRCh38] Chr16:88782050 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3129C>T (p.Leu1043=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002507330]|not provided [RCV000757611] |
Chr16:88731773 [GRCh38] Chr16:88798181 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6963C>T (p.Asn2321=) |
single nucleotide variant |
not provided [RCV000757613]|not specified [RCV001573269] |
Chr16:88716447 [GRCh38] Chr16:88782855 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1387G>A (p.Ala463Thr) |
single nucleotide variant |
not provided [RCV001811475] |
Chr16:88736318 [GRCh38] Chr16:88802726 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3206G>A (p.Trp1069Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000735788] |
Chr16:88727652 [GRCh38] Chr16:88794060 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6208A>C (p.Lys2070Gln) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000735789] |
Chr16:88719917 [GRCh38] Chr16:88786325 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2992-13_2992-12insCCCCCAGACTCAGTGCATCCCCACACCCCCCCCTCCCCAGACTCAGTGCATCCCCACGCCCCGCCCTC |
insertion |
not specified [RCV001001043] |
Chr16:88731922..88731923 [GRCh38] Chr16:88798330..88798331 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3556G>A (p.Gly1186Arg) |
single nucleotide variant |
not specified [RCV001001108] |
Chr16:88726858 [GRCh38] Chr16:88793266 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4495+13_4495+14insGCCCG |
insertion |
none provided [RCV001001848] |
Chr16:88723081..88723082 [GRCh38] Chr16:88789489..88789490 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q11.2-24.3(chr16:46464488-90155062)x3 |
copy number gain |
See cases [RCV000446110] |
Chr16:46464488..90155062 [GRCh37] Chr16:16q11.2-24.3 |
pathogenic |
GRCh37/hg19 16p13.3-q24.3(chr16:69193-90274381)x3 |
copy number gain |
See cases [RCV000446684] |
Chr16:69193..90274381 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4956-3T>C |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788215]|Lymphatic malformation 6 [RCV001788216]|not provided [RCV001810918]|not specified [RCV000428281] |
Chr16:88722069 [GRCh38] Chr16:88788477 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5891T>A (p.Met1964Lys) |
single nucleotide variant |
not provided [RCV000442993] |
Chr16:88720443 [GRCh38] Chr16:88786851 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7500C>T (p.Tyr2500=) |
single nucleotide variant |
not provided [RCV001810922]|not specified [RCV000419651] |
Chr16:88715671 [GRCh38] Chr16:88782079 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3699G>A (p.Ser1233=) |
single nucleotide variant |
not provided [RCV000433825] |
Chr16:88726715 [GRCh38] Chr16:88793123 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2431G>T (p.Glu811Ter) |
single nucleotide variant |
not provided [RCV000482266] |
Chr16:88733644 [GRCh38] Chr16:88800052 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3665A>G (p.Asn1222Ser) |
single nucleotide variant |
not provided [RCV000480143] |
Chr16:88726749 [GRCh38] Chr16:88793157 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7493_7497dup (p.Tyr2500fs) |
duplication |
not provided [RCV000482536] |
Chr16:88715673..88715674 [GRCh38] Chr16:88782081..88782082 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2818G>A (p.Val940Ile) |
single nucleotide variant |
not provided [RCV000485304] |
Chr16:88732508 [GRCh38] Chr16:88798916 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3940C>T (p.Leu1314Phe) |
single nucleotide variant |
not provided [RCV000485812] |
Chr16:88726312 [GRCh38] Chr16:88792720 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3667G>A (p.Val1223Ile) |
single nucleotide variant |
Lymphatic malformation 6 [RCV002272272]|PIEZO1-related condition [RCV003915442]|not provided [RCV000514720] |
Chr16:88726747 [GRCh38] Chr16:88793155 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.7477CTGGAG[3] (p.2493LE[3]) |
microsatellite |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV000049237]|Lymphatic malformation 6 [RCV003444239]|not provided [RCV000485661] |
Chr16:88715682..88715683 [GRCh38] Chr16:88782090..88782091 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.708C>A (p.Cys236Ter) |
single nucleotide variant |
not provided [RCV000479073] |
Chr16:88738367 [GRCh38] Chr16:88804775 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2420G>A (p.Arg807Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV003243146]|not provided [RCV000483062] |
Chr16:88733655 [GRCh38] Chr16:88800063 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:87219866-89561087)x1 |
copy number loss |
not provided [RCV000509325] |
Chr16:87219866..89561087 [GRCh37] Chr16:16q24.2-24.3 |
not provided |
GRCh37/hg19 16q24.2-24.3(chr16:88104077-88958038)x3 |
copy number gain |
See cases [RCV000510568] |
Chr16:88104077..88958038 [GRCh37] Chr16:16q24.2-24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.555C>T (p.Ala185=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002490854]|not provided [RCV000965336] |
Chr16:88738647 [GRCh38] Chr16:88805055 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5629AAG[1] (p.Lys1878del) |
microsatellite |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788240]|Lymphatic malformation 6 [RCV001788241]|not provided [RCV001613332] |
Chr16:88721200..88721202 [GRCh38] Chr16:88787608..88787610 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6390G>A (p.Thr2130=) |
single nucleotide variant |
not provided [RCV001653873]|not specified [RCV001572818] |
Chr16:88719655 [GRCh38] Chr16:88786063 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1219A>G (p.Arg407Gly) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788245]|Lymphatic malformation 6 [RCV001788246]|not provided [RCV001692158] |
Chr16:88736716 [GRCh38] Chr16:88803124 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.63T>G (p.Ala21=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788260]|Lymphatic malformation 6 [RCV001788261]|not provided [RCV001683544] |
Chr16:88784902 [GRCh38] Chr16:88851310 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.635-8C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788254]|Lymphatic malformation 6 [RCV001788255]|not provided [RCV001709660] |
Chr16:88738448 [GRCh38] Chr16:88804856 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2361G>C (p.Arg787=) |
single nucleotide variant |
not provided [RCV001595012]|not specified [RCV001573480] |
Chr16:88733714 [GRCh38] Chr16:88800122 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.645C>G (p.His215Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002527366]|PIEZO1-related condition [RCV003902810]|not provided [RCV000506188] |
Chr16:88738430 [GRCh38] Chr16:88804838 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4014T>C (p.Phe1338=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788266]|Lymphatic malformation 6 [RCV001788267]|not provided [RCV001810997] |
Chr16:88725639 [GRCh38] Chr16:88792047 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.2-24.3(chr16:88116155-89524926)x1 |
copy number loss |
See cases [RCV000511455] |
Chr16:88116155..89524926 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.455C>T (p.Pro152Leu) |
single nucleotide variant |
not provided [RCV001613333] |
Chr16:88741488 [GRCh38] Chr16:88807896 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2247GGA[7] (p.Glu756del) |
microsatellite |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002294339]|not provided [RCV001507362]|not specified [RCV001573929] |
Chr16:88733965..88733967 [GRCh38] Chr16:88800373..88800375 [GRCh37] Chr16:16q24.3 |
pathogenic|benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7059T>C (p.Pro2353=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788247]|Lymphatic malformation 6 [RCV001788248]|not provided [RCV001644568] |
Chr16:88716268 [GRCh38] Chr16:88782676 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2031G>A (p.Val677=) |
single nucleotide variant |
not provided [RCV001692160] |
Chr16:88734505 [GRCh38] Chr16:88800913 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5569C>T (p.Pro1857Ser) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788242]|Lymphatic malformation 6 [RCV001788243]|not provided [RCV001692157] |
Chr16:88721265 [GRCh38] Chr16:88787673 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16p13.2-q24.3(chr16:9273328-89548493)x3 |
copy number gain |
See cases [RCV000511622] |
Chr16:9273328..89548493 [GRCh37] Chr16:16p13.2-q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1527C>A (p.Thr509=) |
single nucleotide variant |
not provided [RCV000506775]|not specified [RCV001700136] |
Chr16:88736178 [GRCh38] Chr16:88802586 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3969-5T>C |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788251]|Lymphatic malformation 6 [RCV001788252]|not provided [RCV001692159] |
Chr16:88725689 [GRCh38] Chr16:88792097 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6905G>A (p.Arg2302His) |
single nucleotide variant |
not provided [RCV000506956]|not specified [RCV003493612] |
Chr16:88716580 [GRCh38] Chr16:88782988 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6570A>G (p.Pro2190=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788262]|Lymphatic malformation 6 [RCV001788263]|not provided [RCV001672819] |
Chr16:88717113 [GRCh38] Chr16:88783521 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.2-24.3(chr16:88445490-89319419)x3 |
copy number gain |
See cases [RCV000511531] |
Chr16:88445490..89319419 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.465+8C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788256]|Lymphatic malformation 6 [RCV001788257]|not provided [RCV001712473] |
Chr16:88741470 [GRCh38] Chr16:88807878 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1013C>A (p.Ser338Tyr) |
single nucleotide variant |
not provided [RCV001573295]|not specified [RCV001701024] |
Chr16:88737941 [GRCh38] Chr16:88804349 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1180G>C (p.Val394Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788268]|Lymphatic malformation 6 [RCV001788269]|not provided [RCV001712571] |
Chr16:88737574 [GRCh38] Chr16:88803982 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6793A>G (p.Ile2265Val) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788238]|Lymphatic malformation 6 [RCV001788239]|not provided [RCV001712471] |
Chr16:88716692 [GRCh38] Chr16:88783100 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5513C>T (p.Thr1838Ile) |
single nucleotide variant |
not provided [RCV000492977] |
Chr16:88721321 [GRCh38] Chr16:88787729 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.749T>C (p.Val250Ala) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788253]|Lymphatic malformation 6 [RCV000989649]|not provided [RCV001653871] |
Chr16:88738326 [GRCh38] Chr16:88804734 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1674C>T (p.Pro558=) |
single nucleotide variant |
not provided [RCV001644569]|not specified [RCV001573467] |
Chr16:88735049 [GRCh38] Chr16:88801457 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6642G>C (p.Leu2214=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788249]|Lymphatic malformation 6 [RCV001788250]|not provided [RCV001540561] |
Chr16:88717041 [GRCh38] Chr16:88783449 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2790+10A>G |
single nucleotide variant |
not provided [RCV001618719]|not specified [RCV001573567] |
Chr16:88732597 [GRCh38] Chr16:88799005 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4193C>T (p.Pro1398Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788244]|Lymphatic malformation 6 [RCV000989647]|not provided [RCV001712472] |
Chr16:88725050 [GRCh38] Chr16:88791458 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2608A>G (p.Met870Val) |
single nucleotide variant |
not provided [RCV000493270] |
Chr16:88733334 [GRCh38] Chr16:88799742 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.718A>G (p.Ile240Val) |
single nucleotide variant |
not provided [RCV000508064] |
Chr16:88738357 [GRCh38] Chr16:88804765 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7362C>T (p.Phe2454=) |
single nucleotide variant |
not provided [RCV001653872] |
Chr16:88715809 [GRCh38] Chr16:88782217 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.248T>C (p.Ile83Thr) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788258]|Lymphatic malformation 6 [RCV001788259]|not provided [RCV001712570] |
Chr16:88742335 [GRCh38] Chr16:88808743 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5538C>G (p.Ala1846=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788264]|Lymphatic malformation 6 [RCV001788265]|not provided [RCV001810996] |
Chr16:88721296 [GRCh38] Chr16:88787704 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.1-24.3(chr16:84937273-89836905)x4 |
copy number gain |
See cases [RCV000511606] |
Chr16:84937273..89836905 [GRCh37] Chr16:16q24.1-24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1117C>T (p.Pro373Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003273532] |
Chr16:88737637 [GRCh38] Chr16:88804045 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q11.2-24.3(chr16:46497599-90354753)x1 |
copy number loss |
Poly (ADP-Ribose) polymerase inhibitor response [RCV000626429] |
Chr16:46497599..90354753 [GRCh37] Chr16:16q11.2-24.3 |
drug response |
NM_001142864.4(PIEZO1):c.3361A>G (p.Thr1121Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV003277800] |
Chr16:88727133 [GRCh38] Chr16:88793541 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5282G>C (p.Arg1761Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV003246645] |
Chr16:88721659 [GRCh38] Chr16:88788067 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1529G>A (p.Arg510His) |
single nucleotide variant |
Inborn genetic diseases [RCV003302596] |
Chr16:88736176 [GRCh38] Chr16:88802584 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6582G>A (p.Met2194Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003302633] |
Chr16:88717101 [GRCh38] Chr16:88783509 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6511G>A (p.Val2171Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003302359] |
Chr16:88717172 [GRCh38] Chr16:88783580 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4826G>A (p.Ser1609Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV003275433] |
Chr16:88722347 [GRCh38] Chr16:88788755 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2189C>T (p.Ala730Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003285456] |
Chr16:88734046 [GRCh38] Chr16:88800454 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5911G>A (p.Asp1971Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV003293822]|PIEZO1-related condition [RCV003396988] |
Chr16:88720423 [GRCh38] Chr16:88786831 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1889G>T (p.Trp630Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003256340] |
Chr16:88734758 [GRCh38] Chr16:88801166 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3712G>A (p.Val1238Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003240792]|not provided [RCV003730482] |
Chr16:88726631 [GRCh38] Chr16:88793039 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
GRCh37/hg19 16p13.3-q24.3(chr16:85881-90155062) |
copy number gain |
See cases [RCV000511296] |
Chr16:85881..90155062 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.640G>A (p.Ala214Thr) |
single nucleotide variant |
Congenital isolated adrenocorticotropic hormone deficiency [RCV003225095]|Inborn genetic diseases [RCV004024763]|not provided [RCV000594190] |
Chr16:88738435 [GRCh38] Chr16:88804843 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
GRCh37/hg19 16p13.3-q24.3(chr16:85881-90155062)x3 |
copy number gain |
See cases [RCV000512138] |
Chr16:85881..90155062 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.593C>T (p.Ala198Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003272720] |
Chr16:88738609 [GRCh38] Chr16:88805017 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6556A>G (p.Ile2186Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003249809] |
Chr16:88717127 [GRCh38] Chr16:88783535 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6214A>G (p.Ile2072Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003240263] |
Chr16:88719911 [GRCh38] Chr16:88786319 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q13-24.3(chr16:57051473-89797669)x3 |
copy number gain |
See cases [RCV000512511] |
Chr16:57051473..89797669 [GRCh37] Chr16:16q13-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7381G>A (p.Glu2461Lys) |
single nucleotide variant |
not provided [RCV000597300] |
Chr16:88715790 [GRCh38] Chr16:88782198 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 16q24.1-24.3(chr16:85838574-90155062)x3 |
copy number gain |
See cases [RCV000512440] |
Chr16:85838574..90155062 [GRCh37] Chr16:16q24.1-24.3 |
pathogenic |
GRCh37/hg19 16q23.3-24.3(chr16:83001540-90155062)x3 |
copy number gain |
See cases [RCV000512468] |
Chr16:83001540..90155062 [GRCh37] Chr16:16q23.3-24.3 |
likely pathogenic |
GRCh37/hg19 16q11.2-24.3(chr16:46455960-90354753)x1 |
copy number loss |
Poly (ADP-Ribose) polymerase inhibitor response [RCV000626435] |
Chr16:46455960..90354753 [GRCh37] Chr16:16q11.2-24.3 |
drug response |
NM_001142864.4(PIEZO1):c.7414C>T (p.Pro2472Ser) |
single nucleotide variant |
not provided [RCV000658352] |
Chr16:88715757 [GRCh38] Chr16:88782165 [GRCh37] Chr16:16q24.3 |
uncertain significance |
Single allele |
deletion |
not provided [RCV000677910] |
Chr16:86890893..89398630 [GRCh37] Chr16:16q24.1-24.3 |
pathogenic |
GRCh37/hg19 16q23.2-24.3(chr16:79400436-90155062)x3 |
copy number gain |
not provided [RCV000683845] |
Chr16:79400436..90155062 [GRCh37] Chr16:16q23.2-24.3 |
pathogenic |
GRCh37/hg19 16q22.2-24.3(chr16:72515938-90155062)x3 |
copy number gain |
not provided [RCV000683831] |
Chr16:72515938..90155062 [GRCh37] Chr16:16q22.2-24.3 |
pathogenic |
GRCh37/hg19 16q24.2-24.3(chr16:88317240-89079407)x3 |
copy number gain |
not provided [RCV000709990] |
Chr16:88317240..89079407 [GRCh37] Chr16:16q24.2-24.3 |
not provided |
NM_001142864.4(PIEZO1):c.4770G>A (p.Val1590=) |
single nucleotide variant |
not provided [RCV001811574] |
Chr16:88722588 [GRCh38] Chr16:88788996 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4997C>T (p.Ala1666Val) |
single nucleotide variant |
not provided [RCV001811575] |
Chr16:88722025 [GRCh38] Chr16:88788433 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3740T>G (p.Phe1247Cys) |
single nucleotide variant |
not provided [RCV001368417]|not specified [RCV001000920] |
Chr16:88726603 [GRCh38] Chr16:88793011 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6421G>A (p.Asp2141Asn) |
single nucleotide variant |
not provided [RCV003490003]|not specified [RCV001000994] |
Chr16:88719624 [GRCh38] Chr16:88786032 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5461G>A (p.Gly1821Ser) |
single nucleotide variant |
not provided [RCV001811604] |
Chr16:88721373 [GRCh38] Chr16:88787781 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4211G>C (p.Arg1404Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV003307796]|not specified [RCV001001974] |
Chr16:88725032 [GRCh38] Chr16:88791440 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5068C>T (p.Leu1690Phe) |
single nucleotide variant |
not specified [RCV001002042] |
Chr16:88721954 [GRCh38] Chr16:88788362 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5195C>T (p.Thr1732Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002488373]|not provided [RCV001551676]|not specified [RCV001699815] |
Chr16:88721827 [GRCh38] Chr16:88788235 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
GRCh37/hg19 16p13.3-q24.3(chr16:88165-90163275)x3 |
copy number gain |
not provided [RCV000738917] |
Chr16:88165..90163275 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
GRCh37/hg19 16p13.3-q24.3(chr16:88165-90274695)x3 |
copy number gain |
not provided [RCV000738918] |
Chr16:88165..90274695 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
GRCh37/hg19 16p13.3-q24.3(chr16:61451-90294632)x3 |
copy number gain |
not provided [RCV000738915] |
Chr16:61451..90294632 [GRCh37] Chr16:16p13.3-q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4495+10_4495+14dup |
duplication |
not provided [RCV001730275] |
Chr16:88723080..88723081 [GRCh38] Chr16:88789488..88789489 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4371G>A (p.Ala1457=) |
single nucleotide variant |
not provided [RCV000959947] |
Chr16:88723293 [GRCh38] Chr16:88789701 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7218C>T (p.Ile2406=) |
single nucleotide variant |
not provided [RCV001531859] |
Chr16:88716031 [GRCh38] Chr16:88782439 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4775+88A>C |
single nucleotide variant |
not provided [RCV001666826] |
Chr16:88722495 [GRCh38] Chr16:88788903 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3302-21G>A |
single nucleotide variant |
not provided [RCV001678725] |
Chr16:88727213 [GRCh38] Chr16:88793621 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4439-8G>T |
single nucleotide variant |
PIEZO1-related condition [RCV003978403]|not provided [RCV000963347] |
Chr16:88723159 [GRCh38] Chr16:88789567 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5647C>T (p.Arg1883Trp) |
single nucleotide variant |
not provided [RCV001751545] |
Chr16:88721187 [GRCh38] Chr16:88787595 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6211T>C (p.Cys2071Arg) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001533181] |
Chr16:88719914 [GRCh38] Chr16:88786322 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6007G>A (p.Ala2003Thr) |
single nucleotide variant |
not provided [RCV001812386] |
Chr16:88720226 [GRCh38] Chr16:88786634 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3523T>G (p.Phe1175Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003938598]|not provided [RCV001812411] |
Chr16:88726891 [GRCh38] Chr16:88793299 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2991+25C>T |
single nucleotide variant |
not provided [RCV001690289] |
Chr16:88732310 [GRCh38] Chr16:88798718 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4956-70C>T |
single nucleotide variant |
not provided [RCV001709003] |
Chr16:88722136 [GRCh38] Chr16:88788544 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3700-18_3700-17insGCCCCGCTG |
insertion |
none provided [RCV001286760] |
Chr16:88726660..88726661 [GRCh38] Chr16:88793068..88793069 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2130C>T (p.Asp710=) |
single nucleotide variant |
not provided [RCV001539875] |
Chr16:88734406 [GRCh38] Chr16:88800814 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3196+188T>C |
single nucleotide variant |
not provided [RCV001610268] |
Chr16:88731518 [GRCh38] Chr16:88797926 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1195+35C>T |
single nucleotide variant |
not provided [RCV001583658] |
Chr16:88737524 [GRCh38] Chr16:88803932 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4190C>T (p.Pro1397Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004029683]|PIEZO1-related condition [RCV003978112]|not provided [RCV000939141] |
Chr16:88725053 [GRCh38] Chr16:88791461 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.160+265dup |
duplication |
not provided [RCV001565652] |
Chr16:88749118..88749119 [GRCh38] Chr16:88815526..88815527 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.465+156G>A |
single nucleotide variant |
not provided [RCV001725330] |
Chr16:88741322 [GRCh38] Chr16:88807730 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.64+269G>A |
single nucleotide variant |
not provided [RCV001679321] |
Chr16:88784632 [GRCh38] Chr16:88851040 [GRCh37] Chr16:16q24.3 |
benign |
NC_000016.10:g.88785260T>G |
single nucleotide variant |
not provided [RCV001535119] |
Chr16:88785260 [GRCh38] Chr16:88851668 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5442C>T (p.Ser1814=) |
single nucleotide variant |
not provided [RCV000895029] |
Chr16:88721392 [GRCh38] Chr16:88787800 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.954C>T (p.Val318=) |
single nucleotide variant |
not provided [RCV001573245] |
Chr16:88738000 [GRCh38] Chr16:88804408 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4668+67C>T |
single nucleotide variant |
not provided [RCV001535373] |
Chr16:88722770 [GRCh38] Chr16:88789178 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5413C>T (p.Leu1805Phe) |
single nucleotide variant |
PIEZO1-related condition [RCV003922849]|not provided [RCV000895322] |
Chr16:88721421 [GRCh38] Chr16:88787829 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6891C>T (p.Ala2297=) |
single nucleotide variant |
not provided [RCV000895361]|not specified [RCV001701242] |
Chr16:88716594 [GRCh38] Chr16:88783002 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.666C>T (p.Val222=) |
single nucleotide variant |
not provided [RCV000914411] |
Chr16:88738409 [GRCh38] Chr16:88804817 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.327-87A>G |
single nucleotide variant |
not provided [RCV001666690] |
Chr16:88741703 [GRCh38] Chr16:88808111 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1997+56G>A |
single nucleotide variant |
not provided [RCV001610876] |
Chr16:88734594 [GRCh38] Chr16:88801002 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2423G>A (p.Arg808Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003967674]|not provided [RCV000756475]|not specified [RCV003320463] |
Chr16:88733652 [GRCh38] Chr16:88800060 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4252T>C (p.Tyr1418His) |
single nucleotide variant |
Inborn genetic diseases [RCV003303228]|PIEZO1-related condition [RCV003908067]|not provided [RCV000756483] |
Chr16:88723954 [GRCh38] Chr16:88790362 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1105C>T (p.Gln369Ter) |
single nucleotide variant |
not provided [RCV000760794] |
Chr16:88737730 [GRCh38] Chr16:88804138 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3301+93A>G |
single nucleotide variant |
not provided [RCV001669379] |
Chr16:88727464 [GRCh38] Chr16:88793872 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5101G>A (p.Val1701Ile) |
single nucleotide variant |
not provided [RCV003238981] |
Chr16:88721921 [GRCh38] Chr16:88788329 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.160+144del |
deletion |
not provided [RCV001570127] |
Chr16:88749240 [GRCh38] Chr16:88815648 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1495G>A (p.Val499Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV004039398]|not provided [RCV001573116] |
Chr16:88736210 [GRCh38] Chr16:88802618 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.326+150A>G |
single nucleotide variant |
not provided [RCV001547076] |
Chr16:88741903 [GRCh38] Chr16:88808311 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3968+163C>T |
single nucleotide variant |
not provided [RCV001566686] |
Chr16:88726121 [GRCh38] Chr16:88792529 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1447G>C (p.Val483Leu) |
single nucleotide variant |
not provided [RCV000756480] |
Chr16:88736258 [GRCh38] Chr16:88802666 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5390G>A (p.Arg1797His) |
single nucleotide variant |
Inborn genetic diseases [RCV002536561]|not provided [RCV000756484] |
Chr16:88721551 [GRCh38] Chr16:88787959 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3797-33_3797-27dup |
duplication |
not provided [RCV001578084] |
Chr16:88726481..88726482 [GRCh38] Chr16:88792889..88792890 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.160+176G>C |
single nucleotide variant |
not provided [RCV001586205] |
Chr16:88749208 [GRCh38] Chr16:88815616 [GRCh37] Chr16:16q24.3 |
likely benign |
GRCh37/hg19 16q24.3(chr16:88713533-88799238)x1 |
copy number loss |
not provided [RCV000751821] |
Chr16:88713533..88799238 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88770621-88812250)x3 |
copy number gain |
not provided [RCV000751822] |
Chr16:88770621..88812250 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88773893-88812250)x1 |
copy number loss |
not provided [RCV000751823] |
Chr16:88773893..88812250 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88787052-88804765)x3 |
copy number gain |
not provided [RCV000751824] |
Chr16:88787052..88804765 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88787052-88877960)x3 |
copy number gain |
not provided [RCV000751825] |
Chr16:88787052..88877960 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88788235-88804365)x1 |
copy number loss |
not provided [RCV000751826] |
Chr16:88788235..88804365 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88799238-88830836)x1 |
copy number loss |
not provided [RCV000751827] |
Chr16:88799238..88830836 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88822747-88849421)x1 |
copy number loss |
not provided [RCV000751828] |
Chr16:88822747..88849421 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88847681-88880480)x3 |
copy number gain |
not provided [RCV000751829] |
Chr16:88847681..88880480 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4162+121C>T |
single nucleotide variant |
not provided [RCV001612867] |
Chr16:88725295 [GRCh38] Chr16:88791703 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88851102-88880480)x1 |
copy number loss |
not provided [RCV000751830] |
Chr16:88851102..88880480 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q24.3(chr16:88851102-88891026)x1 |
copy number loss |
not provided [RCV000751831] |
Chr16:88851102..88891026 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6472-284T>C |
single nucleotide variant |
not provided [RCV001648886] |
Chr16:88717495 [GRCh38] Chr16:88783903 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2730C>T (p.Pro910=) |
single nucleotide variant |
PIEZO1-related condition [RCV003960464]|not provided [RCV000927956] |
Chr16:88732667 [GRCh38] Chr16:88799075 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.180G>A (p.Leu60=) |
single nucleotide variant |
not provided [RCV000927957] |
Chr16:88742403 [GRCh38] Chr16:88808811 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4674C>T (p.Gly1558=) |
single nucleotide variant |
not provided [RCV000906646] |
Chr16:88722684 [GRCh38] Chr16:88789092 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5148G>T (p.Leu1716=) |
single nucleotide variant |
PIEZO1-related condition [RCV003903222]|not provided [RCV000951332] |
Chr16:88721874 [GRCh38] Chr16:88788282 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3171G>C (p.Leu1057=) |
single nucleotide variant |
not provided [RCV000982758] |
Chr16:88731731 [GRCh38] Chr16:88798139 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3797-7C>T |
single nucleotide variant |
not provided [RCV000943299] |
Chr16:88726462 [GRCh38] Chr16:88792870 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2655C>T (p.Asn885=) |
single nucleotide variant |
not provided [RCV000901580] |
Chr16:88733287 [GRCh38] Chr16:88799695 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3793G>A (p.Asp1265Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002548351]|PIEZO1-related condition [RCV003918448]|not provided [RCV000970895] |
Chr16:88726550 [GRCh38] Chr16:88792958 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.190C>T (p.Leu64=) |
single nucleotide variant |
not provided [RCV000922815] |
Chr16:88742393 [GRCh38] Chr16:88808801 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5280G>T (p.Leu1760=) |
single nucleotide variant |
not provided [RCV000900666] |
Chr16:88721661 [GRCh38] Chr16:88788069 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7240G>A (p.Asp2414Asn) |
single nucleotide variant |
not provided [RCV000880696] |
Chr16:88716009 [GRCh38] Chr16:88782417 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5215-5C>G |
single nucleotide variant |
not provided [RCV000903348] |
Chr16:88721731 [GRCh38] Chr16:88788139 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7530G>A (p.Pro2510=) |
single nucleotide variant |
not provided [RCV000972317] |
Chr16:88715641 [GRCh38] Chr16:88782049 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7194C>T (p.Thr2398=) |
single nucleotide variant |
not provided [RCV000972318] |
Chr16:88716055 [GRCh38] Chr16:88782463 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5769C>T (p.Ala1923=) |
single nucleotide variant |
not provided [RCV000972319] |
Chr16:88720648 [GRCh38] Chr16:88787056 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5115C>T (p.Ala1705=) |
single nucleotide variant |
not provided [RCV000906066] |
Chr16:88721907 [GRCh38] Chr16:88788315 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.987G>T (p.Leu329=) |
single nucleotide variant |
not provided [RCV000903137] |
Chr16:88737967 [GRCh38] Chr16:88804375 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5121G>T (p.Ser1707=) |
single nucleotide variant |
not provided [RCV000914484] |
Chr16:88721901 [GRCh38] Chr16:88788309 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4713C>T (p.Ser1571=) |
single nucleotide variant |
PIEZO1-related condition [RCV003913113]|not provided [RCV000924045] |
Chr16:88722645 [GRCh38] Chr16:88789053 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6219C>T (p.Tyr2073=) |
single nucleotide variant |
not provided [RCV000949998] |
Chr16:88719906 [GRCh38] Chr16:88786314 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6164+10C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003955871]|not provided [RCV000883833] |
Chr16:88720059 [GRCh38] Chr16:88786467 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1656C>T (p.Thr552=) |
single nucleotide variant |
not provided [RCV000980936] |
Chr16:88735148 [GRCh38] Chr16:88801556 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5404-10C>T |
single nucleotide variant |
not provided [RCV000924069] |
Chr16:88721440 [GRCh38] Chr16:88787848 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2907C>T (p.Ser969=) |
single nucleotide variant |
PIEZO1-related condition [RCV003960435]|not provided [RCV000924947] |
Chr16:88732419 [GRCh38] Chr16:88798827 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5401C>T (p.Leu1801=) |
single nucleotide variant |
not provided [RCV000936692] |
Chr16:88721540 [GRCh38] Chr16:88787948 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.825C>G (p.Leu275=) |
single nucleotide variant |
not provided [RCV000919939] |
Chr16:88738250 [GRCh38] Chr16:88804658 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2689C>T (p.Leu897=) |
single nucleotide variant |
not provided [RCV000892303] |
Chr16:88732708 [GRCh38] Chr16:88799116 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1297-6G>A |
single nucleotide variant |
not provided [RCV000966403] |
Chr16:88736414 [GRCh38] Chr16:88802822 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1281G>A (p.Ala427=) |
single nucleotide variant |
not provided [RCV000966404] |
Chr16:88736654 [GRCh38] Chr16:88803062 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1072C>T (p.Leu358=) |
single nucleotide variant |
not provided [RCV000966405] |
Chr16:88737763 [GRCh38] Chr16:88804171 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4695G>C (p.Leu1565=) |
single nucleotide variant |
not provided [RCV000900917] |
Chr16:88722663 [GRCh38] Chr16:88789071 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4496-8T>A |
single nucleotide variant |
PIEZO1-related condition [RCV003978070]|not provided [RCV000928147] |
Chr16:88723017 [GRCh38] Chr16:88789425 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6822C>T (p.Ser2274=) |
single nucleotide variant |
not provided [RCV000906235] |
Chr16:88716663 [GRCh38] Chr16:88783071 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4385G>A (p.Arg1462Gln) |
single nucleotide variant |
not provided [RCV000879327]|not specified [RCV001701341] |
Chr16:88723279 [GRCh38] Chr16:88789687 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2496G>A (p.Val832=) |
single nucleotide variant |
not provided [RCV000883386] |
Chr16:88733446 [GRCh38] Chr16:88799854 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2157G>A (p.Thr719=) |
single nucleotide variant |
not provided [RCV000915048] |
Chr16:88734379 [GRCh38] Chr16:88800787 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3434T>C (p.Val1145Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV004027129]|not provided [RCV000756476] |
Chr16:88727060 [GRCh38] Chr16:88793468 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6657T>C (p.Tyr2219=) |
single nucleotide variant |
not provided [RCV000881969] |
Chr16:88717026 [GRCh38] Chr16:88783434 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4719C>T (p.Ala1573=) |
single nucleotide variant |
PIEZO1-related condition [RCV003908401]|not provided [RCV000880052] |
Chr16:88722639 [GRCh38] Chr16:88789047 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6297T>C (p.Asn2099=) |
single nucleotide variant |
not provided [RCV000879463] |
Chr16:88719828 [GRCh38] Chr16:88786236 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6933G>A (p.Leu2311=) |
single nucleotide variant |
not provided [RCV000983487] |
Chr16:88716477 [GRCh38] Chr16:88782885 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4023G>A (p.Arg1341=) |
single nucleotide variant |
PIEZO1-related condition [RCV003913135]|not provided [RCV000927158] |
Chr16:88725630 [GRCh38] Chr16:88792038 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.284-4G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003913171]|not provided [RCV000937871] |
Chr16:88742099 [GRCh38] Chr16:88808507 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3387C>T (p.Gly1129=) |
single nucleotide variant |
not provided [RCV000925407] |
Chr16:88727107 [GRCh38] Chr16:88793515 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1128C>G (p.Pro376=) |
single nucleotide variant |
not provided [RCV000929029] |
Chr16:88737626 [GRCh38] Chr16:88804034 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6423C>T (p.Asp2141=) |
single nucleotide variant |
not provided [RCV000903103] |
Chr16:88719622 [GRCh38] Chr16:88786030 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5721G>T (p.Thr1907=) |
single nucleotide variant |
not provided [RCV000905436] |
Chr16:88720696 [GRCh38] Chr16:88787104 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4992G>A (p.Leu1664=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002479007]|PIEZO1-related condition [RCV003955881]|not provided [RCV000884750] |
Chr16:88722030 [GRCh38] Chr16:88788438 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3636C>T (p.Leu1212=) |
single nucleotide variant |
not provided [RCV000884751] |
Chr16:88726778 [GRCh38] Chr16:88793186 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1688C>T (p.Thr563Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002540175]|PIEZO1-related condition [RCV003958104]|not provided [RCV000898908] |
Chr16:88735035 [GRCh38] Chr16:88801443 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.948C>T (p.Pro316=) |
single nucleotide variant |
not provided [RCV000923752] |
Chr16:88738006 [GRCh38] Chr16:88804414 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5694G>C (p.Glu1898Asp) |
single nucleotide variant |
PIEZO1-related condition [RCV003910387]|not provided [RCV000881409] |
Chr16:88720723 [GRCh38] Chr16:88787131 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2421G>C (p.Arg807=) |
single nucleotide variant |
not provided [RCV000881410] |
Chr16:88733654 [GRCh38] Chr16:88800062 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1683G>A (p.Thr561=) |
single nucleotide variant |
not provided [RCV000900035] |
Chr16:88735040 [GRCh38] Chr16:88801448 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.690C>T (p.Leu230=) |
single nucleotide variant |
not provided [RCV000899086] |
Chr16:88738385 [GRCh38] Chr16:88804793 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2991+12A>G |
single nucleotide variant |
not provided [RCV001573035]|not specified [RCV001700731] |
Chr16:88732323 [GRCh38] Chr16:88798731 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2664+12C>G |
single nucleotide variant |
not provided [RCV001685348]|not specified [RCV001573824] |
Chr16:88733266 [GRCh38] Chr16:88799674 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4009G>A (p.Asp1337Asn) |
single nucleotide variant |
not provided [RCV001813105] |
Chr16:88725644 [GRCh38] Chr16:88792052 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2463C>T (p.Tyr821=) |
single nucleotide variant |
not provided [RCV000977982] |
Chr16:88733612 [GRCh38] Chr16:88800020 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.65-4G>A |
single nucleotide variant |
not provided [RCV000917060] |
Chr16:88749483 [GRCh38] Chr16:88815891 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4388AGCAGG[4] (p.1465EQ[3]) |
microsatellite |
not provided [RCV000948443] |
Chr16:88723258..88723259 [GRCh38] Chr16:88789666..88789667 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5963C>T (p.Ala1988Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003903126]|not provided [RCV000939246] |
Chr16:88720270 [GRCh38] Chr16:88786678 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1791C>T (p.Leu597=) |
single nucleotide variant |
not provided [RCV000895615] |
Chr16:88734932 [GRCh38] Chr16:88801340 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5718C>T (p.Pro1906=) |
single nucleotide variant |
not provided [RCV000917693] |
Chr16:88720699 [GRCh38] Chr16:88787107 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.997C>T (p.Arg333Cys) |
single nucleotide variant |
not provided [RCV000879833] |
Chr16:88737957 [GRCh38] Chr16:88804365 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6792C>T (p.Asp2264=) |
single nucleotide variant |
not provided [RCV000910429] |
Chr16:88716693 [GRCh38] Chr16:88783101 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5011C>A (p.Arg1671=) |
single nucleotide variant |
not provided [RCV000938688] |
Chr16:88722011 [GRCh38] Chr16:88788419 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7389G>A (p.Ser2463=) |
single nucleotide variant |
not provided [RCV000942636] |
Chr16:88715782 [GRCh38] Chr16:88782190 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6903G>A (p.Leu2301=) |
single nucleotide variant |
not provided [RCV000895428] |
Chr16:88716582 [GRCh38] Chr16:88782990 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6927G>A (p.Arg2309=) |
single nucleotide variant |
not provided [RCV000939946] |
Chr16:88716483 [GRCh38] Chr16:88782891 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4290G>C (p.Glu1430Asp) |
single nucleotide variant |
not provided [RCV000981857] |
Chr16:88723916 [GRCh38] Chr16:88790324 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1196-9C>T |
single nucleotide variant |
not provided [RCV000900328] |
Chr16:88736748 [GRCh38] Chr16:88803156 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5283G>A (p.Arg1761=) |
single nucleotide variant |
PIEZO1-related condition [RCV003977935]|not provided [RCV000907125] |
Chr16:88721658 [GRCh38] Chr16:88788066 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2664+8C>T |
single nucleotide variant |
not provided [RCV000930852] |
Chr16:88733270 [GRCh38] Chr16:88799678 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1647G>A (p.Thr549=) |
single nucleotide variant |
not provided [RCV000893165] |
Chr16:88735157 [GRCh38] Chr16:88801565 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1702C>T (p.Leu568=) |
single nucleotide variant |
PIEZO1-related condition [RCV003926180]|not provided [RCV000962440] |
Chr16:88735021 [GRCh38] Chr16:88801429 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.999C>T (p.Arg333=) |
single nucleotide variant |
not provided [RCV000943209] |
Chr16:88737955 [GRCh38] Chr16:88804363 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4336-5G>C |
single nucleotide variant |
not provided [RCV000930933] |
Chr16:88723333 [GRCh38] Chr16:88789741 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.748G>A (p.Val250Ile) |
single nucleotide variant |
not provided [RCV000961370] |
Chr16:88738327 [GRCh38] Chr16:88804735 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.985C>G (p.Leu329Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003960722]|not provided [RCV000962566] |
Chr16:88737969 [GRCh38] Chr16:88804377 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1251C>T (p.His417=) |
single nucleotide variant |
not provided [RCV000903114] |
Chr16:88736684 [GRCh38] Chr16:88803092 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2742C>A (p.Ala914=) |
single nucleotide variant |
PIEZO1-related condition [RCV003920843]|not provided [RCV000896186] |
Chr16:88732655 [GRCh38] Chr16:88799063 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5163G>A (p.Ser1721=) |
single nucleotide variant |
not provided [RCV000938081] |
Chr16:88721859 [GRCh38] Chr16:88788267 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1806T>C (p.Ile602=) |
single nucleotide variant |
not provided [RCV000921069] |
Chr16:88734917 [GRCh38] Chr16:88801325 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7317-5C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002495448]|not provided [RCV000900445] |
Chr16:88715859 [GRCh38] Chr16:88782267 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4506T>C (p.His1502=) |
single nucleotide variant |
not provided [RCV000914848] |
Chr16:88722999 [GRCh38] Chr16:88789407 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1641G>A (p.Ala547=) |
single nucleotide variant |
not provided [RCV000918662] |
Chr16:88735163 [GRCh38] Chr16:88801571 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2469C>T (p.Val823=) |
single nucleotide variant |
not provided [RCV000979684] |
Chr16:88733606 [GRCh38] Chr16:88800014 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7130-5C>A |
single nucleotide variant |
PIEZO1-related condition [RCV003943125]|not provided [RCV000963148] |
Chr16:88716124 [GRCh38] Chr16:88782532 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4580G>A (p.Arg1527His) |
single nucleotide variant |
PIEZO1-related condition [RCV003912832]|not provided [RCV000898907]|not specified [RCV001572652] |
Chr16:88722925 [GRCh38] Chr16:88789333 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6164+3G>A |
single nucleotide variant |
not provided [RCV000924317] |
Chr16:88720066 [GRCh38] Chr16:88786474 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6231C>T (p.Ser2077=) |
single nucleotide variant |
not provided [RCV000896332] |
Chr16:88719894 [GRCh38] Chr16:88786302 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3813C>T (p.Asp1271=) |
single nucleotide variant |
not provided [RCV000897488] |
Chr16:88726439 [GRCh38] Chr16:88792847 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5886C>T (p.Ala1962=) |
single nucleotide variant |
not provided [RCV000896590] |
Chr16:88720448 [GRCh38] Chr16:88786856 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7426C>T (p.Arg2476Cys) |
single nucleotide variant |
PIEZO1-related condition [RCV003920602]|not provided [RCV000884095] |
Chr16:88715745 [GRCh38] Chr16:88782153 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1465C>G (p.Arg489Gly) |
single nucleotide variant |
not provided [RCV000879412] |
Chr16:88736240 [GRCh38] Chr16:88802648 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4737C>A (p.Gly1579=) |
single nucleotide variant |
not provided [RCV000895323] |
Chr16:88722621 [GRCh38] Chr16:88789029 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.94C>A (p.Leu32Met) |
single nucleotide variant |
Inborn genetic diseases [RCV004028474]|PIEZO1-related condition [RCV003920857]|not provided [RCV000897670] |
Chr16:88749450 [GRCh38] Chr16:88815858 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5310G>A (p.Pro1770=) |
single nucleotide variant |
not provided [RCV000922355] |
Chr16:88721631 [GRCh38] Chr16:88788039 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5112C>T (p.Ser1704=) |
single nucleotide variant |
not provided [RCV000927334] |
Chr16:88721910 [GRCh38] Chr16:88788318 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1199G>A (p.Arg400Gln) |
single nucleotide variant |
not provided [RCV000972910] |
Chr16:88736736 [GRCh38] Chr16:88803144 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6249C>T (p.Cys2083=) |
single nucleotide variant |
not provided [RCV000916388] |
Chr16:88719876 [GRCh38] Chr16:88786284 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6294C>T (p.Tyr2098=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002489358]|not provided [RCV000961368] |
Chr16:88719831 [GRCh38] Chr16:88786239 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3456-10G>A |
single nucleotide variant |
not provided [RCV000967427] |
Chr16:88726968 [GRCh38] Chr16:88793376 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5853C>T (p.His1951=) |
single nucleotide variant |
not provided [RCV000947734] |
Chr16:88720481 [GRCh38] Chr16:88786889 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4363G>A (p.Ala1455Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002547250]|not provided [RCV000954300] |
Chr16:88723301 [GRCh38] Chr16:88789709 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6651C>A (p.Gly2217=) |
single nucleotide variant |
not provided [RCV000963507]|not specified [RCV001573645] |
Chr16:88717032 [GRCh38] Chr16:88783440 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5828G>A (p.Arg1943Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003910371]|not provided [RCV000880446] |
Chr16:88720506 [GRCh38] Chr16:88786914 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6828G>A (p.Ala2276=) |
single nucleotide variant |
not provided [RCV000924575] |
Chr16:88716657 [GRCh38] Chr16:88783065 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7505A>G (p.Lys2502Arg) |
single nucleotide variant |
PIEZO1-related condition [RCV003940438]|not provided [RCV000881821]|not specified [RCV001701344] |
Chr16:88715666 [GRCh38] Chr16:88782074 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2992-7T>C |
single nucleotide variant |
not provided [RCV000905054] |
Chr16:88731917 [GRCh38] Chr16:88798325 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1014C>T (p.Ser338=) |
single nucleotide variant |
not provided [RCV000906460] |
Chr16:88737940 [GRCh38] Chr16:88804348 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4386G>A (p.Arg1462=) |
single nucleotide variant |
not provided [RCV000932511] |
Chr16:88723278 [GRCh38] Chr16:88789686 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3042G>A (p.Leu1014=) |
single nucleotide variant |
not provided [RCV000932512] |
Chr16:88731860 [GRCh38] Chr16:88798268 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3969-8C>T |
single nucleotide variant |
not provided [RCV000899735] |
Chr16:88725692 [GRCh38] Chr16:88792100 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.669C>T (p.Tyr223=) |
single nucleotide variant |
PIEZO1-related condition [RCV003943016]|not provided [RCV000949593] |
Chr16:88738406 [GRCh38] Chr16:88804814 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1989C>T (p.Thr663=) |
single nucleotide variant |
PIEZO1-related condition [RCV003968305]|not provided [RCV000905216] |
Chr16:88734658 [GRCh38] Chr16:88801066 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1179C>G (p.Ser393=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002501412]|not provided [RCV000884752] |
Chr16:88737575 [GRCh38] Chr16:88803983 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5241C>T (p.Phe1747=) |
single nucleotide variant |
not provided [RCV000930403] |
Chr16:88721700 [GRCh38] Chr16:88788108 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4668+8T>G |
single nucleotide variant |
not provided [RCV000896857] |
Chr16:88722829 [GRCh38] Chr16:88789237 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7316+8_7316+11del |
microsatellite |
not provided [RCV000895028] |
Chr16:88715922..88715925 [GRCh38] Chr16:88782330..88782333 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5832C>T (p.Arg1944=) |
single nucleotide variant |
not provided [RCV000978425] |
Chr16:88720502 [GRCh38] Chr16:88786910 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2445C>G (p.Phe815Leu) |
single nucleotide variant |
not provided [RCV002284626] |
Chr16:88733630 [GRCh38] Chr16:88800038 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q23.3-24.3(chr16:82761333-90055381) |
copy number gain |
not provided [RCV000767619] |
Chr16:82761333..90055381 [GRCh37] Chr16:16q23.3-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6315C>G (p.Leu2105=) |
single nucleotide variant |
not provided [RCV000914904] |
Chr16:88719810 [GRCh38] Chr16:88786218 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1427C>T (p.Thr476Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002540885]|PIEZO1-related condition [RCV003978000]|not provided [RCV000915049] |
Chr16:88736278 [GRCh38] Chr16:88802686 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5802-4G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003920766]|not provided [RCV000891547] |
Chr16:88720536 [GRCh38] Chr16:88786944 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7553G>C (p.Arg2518Pro) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000791079]|not provided [RCV003133596] |
Chr16:88715618 [GRCh38] Chr16:88782026 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2492C>T (p.Ser831Leu) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001029735]|not provided [RCV001546117] |
Chr16:88733450 [GRCh38] Chr16:88799858 [GRCh37] Chr16:16q24.3 |
likely pathogenic|uncertain significance |
NM_001142864.4(PIEZO1):c.2005G>T (p.Asp669Tyr) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001029751]|not provided [RCV001784564] |
Chr16:88734531 [GRCh38] Chr16:88800939 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
GRCh37/hg19 16q24.3(chr16:88782844-89140571)x3 |
copy number gain |
not provided [RCV000845893] |
Chr16:88782844..89140571 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3000C>A (p.Phe1000Leu) |
single nucleotide variant |
Lymphatic malformation 6 [RCV000791080]|not provided [RCV003133597] |
Chr16:88731902 [GRCh38] Chr16:88798310 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88697092-88791148)x1 |
copy number loss |
not provided [RCV000846887] |
Chr16:88697092..88791148 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.417C>T (p.Cys139=) |
single nucleotide variant |
not provided [RCV000977785] |
Chr16:88741526 [GRCh38] Chr16:88807934 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2379C>G (p.Ala793=) |
single nucleotide variant |
not provided [RCV000898596] |
Chr16:88733696 [GRCh38] Chr16:88800104 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7101A>G (p.Glu2367=) |
single nucleotide variant |
not provided [RCV000898649] |
Chr16:88716226 [GRCh38] Chr16:88782634 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5988A>G (p.Ser1996=) |
single nucleotide variant |
not provided [RCV000894433] |
Chr16:88720245 [GRCh38] Chr16:88786653 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1141_1143del (p.Asp381del) |
deletion |
not provided [RCV000896578] |
Chr16:88737611..88737613 [GRCh38] Chr16:88804019..88804021 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6734G>A (p.Arg2245Gln) |
single nucleotide variant |
Blood group, ER [RCV003225738]|not provided [RCV000961367] |
Chr16:88716825 [GRCh38] Chr16:88783233 [GRCh37] Chr16:16q24.3 |
affects|benign|likely benign |
NM_001142864.4(PIEZO1):c.6879C>T (p.Tyr2293=) |
single nucleotide variant |
PIEZO1-related condition [RCV003943258]|not provided [RCV000976541] |
Chr16:88716606 [GRCh38] Chr16:88783014 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6804G>A (p.Ala2268=) |
single nucleotide variant |
PIEZO1-related condition [RCV003933054]|not provided [RCV000916416]|not specified [RCV001002420] |
Chr16:88716681 [GRCh38] Chr16:88783089 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1216C>G (p.Pro406Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV003268448] |
Chr16:88736719 [GRCh38] Chr16:88803127 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6828G>C (p.Ala2276=) |
single nucleotide variant |
not provided [RCV000916156] |
Chr16:88716657 [GRCh38] Chr16:88783065 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7041C>T (p.Asp2347=) |
single nucleotide variant |
PIEZO1-related condition [RCV003916039]|not provided [RCV000961077] |
Chr16:88716369 [GRCh38] Chr16:88782777 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
GRCh37/hg19 16q24.2-24.3(chr16:88453448-89569215)x1 |
copy number loss |
not provided [RCV000847422] |
Chr16:88453448..89569215 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.5910C>T (p.Val1970=) |
single nucleotide variant |
not provided [RCV000892799] |
Chr16:88720424 [GRCh38] Chr16:88786832 [GRCh37] Chr16:16q24.3 |
likely benign |
GRCh37/hg19 16q24.2-24.3(chr16:87848902-88809407)x3 |
copy number gain |
not provided [RCV000849210] |
Chr16:87848902..88809407 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6471+9G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003920767]|not provided [RCV000891620] |
Chr16:88719565 [GRCh38] Chr16:88785973 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7389G>T (p.Ser2463=) |
single nucleotide variant |
not provided [RCV000936292] |
Chr16:88715782 [GRCh38] Chr16:88782190 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5290G>T (p.Glu1764Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003492224]|not provided [RCV001171788] |
Chr16:88721651 [GRCh38] Chr16:88788059 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.588G>T (p.Leu196=) |
single nucleotide variant |
not provided [RCV001548717]|not specified [RCV001699499] |
Chr16:88738614 [GRCh38] Chr16:88805022 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6660+17C>T |
single nucleotide variant |
not provided [RCV001644890] |
Chr16:88717006 [GRCh38] Chr16:88783414 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.352G>A (p.Ala118Thr) |
single nucleotide variant |
not specified [RCV001000959] |
Chr16:88741591 [GRCh38] Chr16:88807999 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4373_4387delinsCGGCAGCAGG (p.Val1458fs) |
indel |
Lymphatic malformation 6 [RCV001172313] |
Chr16:88723277..88723291 [GRCh38] Chr16:88789685..88789699 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6154G>A (p.Val2052Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV002551696]|Lymphatic malformation 6 [RCV003458219]|not provided [RCV001509525]|not specified [RCV001002508] |
Chr16:88720079 [GRCh38] Chr16:88786487 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6679G>A (p.Ala2227Thr) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001196779] |
Chr16:88716880 [GRCh38] Chr16:88783288 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6964G>T (p.Glu2322Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001250671] |
Chr16:88716446 [GRCh38] Chr16:88782854 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2857C>T (p.Arg953Cys) |
single nucleotide variant |
not provided [RCV003480219] |
Chr16:88732469 [GRCh38] Chr16:88798877 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4315T>C (p.Ser1439Pro) |
single nucleotide variant |
not provided [RCV003480211] |
Chr16:88723891 [GRCh38] Chr16:88790299 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4918G>A (p.Gly1640Arg) |
single nucleotide variant |
not provided [RCV003480209] |
Chr16:88722255 [GRCh38] Chr16:88788663 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6823G>C (p.Gly2275Arg) |
single nucleotide variant |
not provided [RCV003480207] |
Chr16:88716662 [GRCh38] Chr16:88783070 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7005G>T (p.Arg2335=) |
single nucleotide variant |
not provided [RCV003312354] |
Chr16:88716405 [GRCh38] Chr16:88782813 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1815G>A (p.Met605Ile) |
single nucleotide variant |
not provided [RCV003312355] |
Chr16:88734908 [GRCh38] Chr16:88801316 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1538G>A (p.Cys513Tyr) |
single nucleotide variant |
Inborn genetic diseases [RCV003272494] |
Chr16:88736167 [GRCh38] Chr16:88802575 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2932G>C (p.Asp978His) |
single nucleotide variant |
Inborn genetic diseases [RCV003272495] |
Chr16:88732394 [GRCh38] Chr16:88798802 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4786G>A (p.Ala1596Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV003249173] |
Chr16:88722387 [GRCh38] Chr16:88788795 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6307C>G (p.Leu2103Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003943303]|not provided [RCV000996381] |
Chr16:88719818 [GRCh38] Chr16:88786226 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.752C>T (p.Ala251Val) |
single nucleotide variant |
not provided [RCV000996382] |
Chr16:88738323 [GRCh38] Chr16:88804731 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3000C>G (p.Phe1000Leu) |
single nucleotide variant |
not provided [RCV003127058] |
Chr16:88731902 [GRCh38] Chr16:88798310 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NC_000016.9:g.(?_88788606)_(88792112_?)dup |
duplication |
not provided [RCV003105572] |
Chr16:88788606..88792112 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4234+291G>C |
single nucleotide variant |
not provided [RCV001641823] |
Chr16:88724718 [GRCh38] Chr16:88791126 [GRCh37] Chr16:16q24.3 |
benign |
NM_001012759.3(CTU2):c.1420-37A>G |
single nucleotide variant |
Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome [RCV001658313]|not provided [RCV001615490] |
Chr16:88715011 [GRCh38] Chr16:88781419 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.950G>C (p.Gly317Ala) |
single nucleotide variant |
not provided [RCV001550505] |
Chr16:88738004 [GRCh38] Chr16:88804412 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6781A>G (p.Ser2261Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002570791]|PIEZO1-related condition [RCV003405724]|not provided [RCV001572943] |
Chr16:88716704 [GRCh38] Chr16:88783112 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.3699+35G>T |
single nucleotide variant |
not provided [RCV001570402] |
Chr16:88726680 [GRCh38] Chr16:88793088 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.327-207A>G |
single nucleotide variant |
not provided [RCV001574641] |
Chr16:88741823 [GRCh38] Chr16:88808231 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6472-119T>C |
single nucleotide variant |
not provided [RCV001662893] |
Chr16:88717330 [GRCh38] Chr16:88783738 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2515G>A (p.Val839Met) |
single nucleotide variant |
not provided [RCV003318088] |
Chr16:88733427 [GRCh38] Chr16:88799835 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1690C>G (p.Leu564Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003275469] |
Chr16:88735033 [GRCh38] Chr16:88801441 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6472-290G>A |
single nucleotide variant |
not provided [RCV001686307] |
Chr16:88717501 [GRCh38] Chr16:88783909 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466-138G>A |
single nucleotide variant |
not provided [RCV001614862] |
Chr16:88738874 [GRCh38] Chr16:88805282 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1297-59_1298del |
deletion |
Lymphatic malformation 6 [RCV001732207]|not provided [RCV001560508] |
Chr16:88736407..88736467 [GRCh38] Chr16:88802815..88802875 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1997+32C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788747]|Lymphatic malformation 6 [RCV001788748]|not provided [RCV001675146] |
Chr16:88734618 [GRCh38] Chr16:88801026 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+17A>C |
single nucleotide variant |
not provided [RCV001714840] |
Chr16:88727540 [GRCh38] Chr16:88793948 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.327-137G>A |
single nucleotide variant |
not provided [RCV001596446] |
Chr16:88741753 [GRCh38] Chr16:88808161 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4234+215A>G |
single nucleotide variant |
not provided [RCV001684732] |
Chr16:88724794 [GRCh38] Chr16:88791202 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2665-198C>T |
single nucleotide variant |
not provided [RCV001713546] |
Chr16:88732930 [GRCh38] Chr16:88799338 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-32G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788652]|Lymphatic malformation 6 [RCV001788653]|not provided [RCV001637276] |
Chr16:88742454 [GRCh38] Chr16:88808862 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2181-89_2181-84del |
deletion |
not provided [RCV001612472] |
Chr16:88734138..88734143 [GRCh38] Chr16:88800546..88800551 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2992-46_2992-45insCT |
insertion |
not provided [RCV001556652] |
Chr16:88731955..88731956 [GRCh38] Chr16:88798363..88798364 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6132G>A (p.Trp2044Ter) |
single nucleotide variant |
not provided [RCV002284337] |
Chr16:88720101 [GRCh38] Chr16:88786509 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6660+58G>A |
single nucleotide variant |
not provided [RCV001562301] |
Chr16:88716965 [GRCh38] Chr16:88783373 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001012759.3(CTU2):c.1478+20C>T |
single nucleotide variant |
not provided [RCV001642137] |
Chr16:88715126 [GRCh38] Chr16:88781534 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4163-37T>G |
single nucleotide variant |
not provided [RCV001676497] |
Chr16:88725117 [GRCh38] Chr16:88791525 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2245_2250del (p.Gln749_Glu750del) |
deletion |
not provided [RCV001558588] |
Chr16:88733985..88733990 [GRCh38] Chr16:88800393..88800398 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2665-193C>T |
single nucleotide variant |
not provided [RCV001687731] |
Chr16:88732925 [GRCh38] Chr16:88799333 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1196-48A>G |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788773]|Lymphatic malformation 6 [RCV001788774]|not provided [RCV001694357] |
Chr16:88736787 [GRCh38] Chr16:88803195 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2665-162C>G |
single nucleotide variant |
not provided [RCV001616999] |
Chr16:88732894 [GRCh38] Chr16:88799302 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7091A>G (p.Asn2364Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003284378]|not provided [RCV001573763] |
Chr16:88716236 [GRCh38] Chr16:88782644 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4162+117T>C |
single nucleotide variant |
not provided [RCV001676895] |
Chr16:88725299 [GRCh38] Chr16:88791707 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1768G>A (p.Val590Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003252833] |
Chr16:88734955 [GRCh38] Chr16:88801363 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5720C>T (p.Thr1907Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003242368] |
Chr16:88720697 [GRCh38] Chr16:88787105 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4496-5C>T |
single nucleotide variant |
not provided [RCV000904773] |
Chr16:88723014 [GRCh38] Chr16:88789422 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1782C>T (p.Ala594=) |
single nucleotide variant |
not provided [RCV000929653] |
Chr16:88734941 [GRCh38] Chr16:88801349 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2889C>G (p.Ala963=) |
single nucleotide variant |
PIEZO1-related condition [RCV003910848]|not provided [RCV000907126] |
Chr16:88732437 [GRCh38] Chr16:88798845 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6494AGA[4] (p.Lys2169del) |
microsatellite |
PIEZO1-related condition [RCV003978238]|not provided [RCV000952749] |
Chr16:88717175..88717177 [GRCh38] Chr16:88783583..88783585 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1926C>T (p.Ile642=) |
single nucleotide variant |
PIEZO1-related condition [RCV003960494]|not provided [RCV000932298] |
Chr16:88734721 [GRCh38] Chr16:88801129 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4766C>T (p.Thr1589Ile) |
single nucleotide variant |
not provided [RCV000910541] |
Chr16:88722592 [GRCh38] Chr16:88789000 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1326G>C (p.Leu442=) |
single nucleotide variant |
not provided [RCV000889110] |
Chr16:88736379 [GRCh38] Chr16:88802787 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.835G>A (p.Gly279Ser) |
single nucleotide variant |
not provided [RCV000889111] |
Chr16:88738240 [GRCh38] Chr16:88804648 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1998-10C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003895423]|not provided [RCV000885312] |
Chr16:88734548 [GRCh38] Chr16:88800956 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.635-4G>A |
single nucleotide variant |
not provided [RCV000900036] |
Chr16:88738444 [GRCh38] Chr16:88804852 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3928G>A (p.Val1310Ile) |
single nucleotide variant |
PIEZO1-related condition [RCV003910503]|not provided [RCV000887226] |
Chr16:88726324 [GRCh38] Chr16:88792732 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2982C>T (p.Phe994=) |
single nucleotide variant |
not provided [RCV000931638] |
Chr16:88732344 [GRCh38] Chr16:88798752 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1779C>T (p.Phe593=) |
single nucleotide variant |
not provided [RCV000922617] |
Chr16:88734944 [GRCh38] Chr16:88801352 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7023G>A (p.Leu2341=) |
single nucleotide variant |
not provided [RCV000927615] |
Chr16:88716387 [GRCh38] Chr16:88782795 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1296+7G>A |
single nucleotide variant |
not provided [RCV000885409] |
Chr16:88736632 [GRCh38] Chr16:88803040 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2622C>T (p.Leu874=) |
single nucleotide variant |
not provided [RCV000932469] |
Chr16:88733320 [GRCh38] Chr16:88799728 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5865C>T (p.Arg1955=) |
single nucleotide variant |
PIEZO1-related condition [RCV003932966]|not provided [RCV000909908] |
Chr16:88720469 [GRCh38] Chr16:88786877 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7296C>T (p.Leu2432=) |
single nucleotide variant |
not provided [RCV000918498] |
Chr16:88715953 [GRCh38] Chr16:88782361 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2940C>T (p.Leu980=) |
single nucleotide variant |
not provided [RCV000908429] |
Chr16:88732386 [GRCh38] Chr16:88798794 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5668+8C>T |
single nucleotide variant |
not provided [RCV000979646] |
Chr16:88721158 [GRCh38] Chr16:88787566 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5214+8G>A |
single nucleotide variant |
not provided [RCV000922956] |
Chr16:88721800 [GRCh38] Chr16:88788208 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2685C>T (p.Asn895=) |
single nucleotide variant |
not provided [RCV000885311] |
Chr16:88732712 [GRCh38] Chr16:88799120 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7524C>T (p.Arg2508=) |
single nucleotide variant |
not provided [RCV000931788] |
Chr16:88715647 [GRCh38] Chr16:88782055 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5133C>T (p.Pro1711=) |
single nucleotide variant |
not provided [RCV000932602] |
Chr16:88721889 [GRCh38] Chr16:88788297 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3666C>T (p.Asn1222=) |
single nucleotide variant |
not provided [RCV000888196] |
Chr16:88726748 [GRCh38] Chr16:88793156 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7332C>T (p.Tyr2444=) |
single nucleotide variant |
not provided [RCV000960970] |
Chr16:88715839 [GRCh38] Chr16:88782247 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6165-7G>A |
single nucleotide variant |
not provided [RCV000894228] |
Chr16:88719967 [GRCh38] Chr16:88786375 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6129A>C (p.Leu2043=) |
single nucleotide variant |
PIEZO1-related condition [RCV003912863]|not provided [RCV000900905] |
Chr16:88720104 [GRCh38] Chr16:88786512 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2529C>T (p.Phe843=) |
single nucleotide variant |
PIEZO1-related condition [RCV003942828]|not provided [RCV000919499] |
Chr16:88733413 [GRCh38] Chr16:88799821 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5728G>A (p.Glu1910Lys) |
single nucleotide variant |
PIEZO1-related condition [RCV003935808]|not provided [RCV000953031] |
Chr16:88720689 [GRCh38] Chr16:88787097 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5139C>T (p.Leu1713=) |
single nucleotide variant |
PIEZO1-related condition [RCV003935809]|not provided [RCV000953032] |
Chr16:88721883 [GRCh38] Chr16:88788291 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2139C>T (p.His713=) |
single nucleotide variant |
not provided [RCV000953033] |
Chr16:88734397 [GRCh38] Chr16:88800805 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3474G>T (p.Leu1158=) |
single nucleotide variant |
not provided [RCV000885630] |
Chr16:88726940 [GRCh38] Chr16:88793348 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1849-6C>T |
single nucleotide variant |
not provided [RCV000879328] |
Chr16:88734804 [GRCh38] Chr16:88801212 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1112T>G (p.Val371Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002539352]|not provided [RCV000886193] |
Chr16:88737642 [GRCh38] Chr16:88804050 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5913C>T (p.Asp1971=) |
single nucleotide variant |
not provided [RCV000930234] |
Chr16:88720421 [GRCh38] Chr16:88786829 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3363A>G (p.Thr1121=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002505445]|not provided [RCV000961369] |
Chr16:88727131 [GRCh38] Chr16:88793539 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5883T>C (p.Tyr1961=) |
single nucleotide variant |
PIEZO1-related condition [RCV003940483]|not provided [RCV000884096] |
Chr16:88720451 [GRCh38] Chr16:88786859 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5627G>A (p.Arg1876Lys) |
single nucleotide variant |
not provided [RCV000892527]|not specified [RCV002268349] |
Chr16:88721207 [GRCh38] Chr16:88787615 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.567A>C (p.Arg189=) |
single nucleotide variant |
not provided [RCV000939722] |
Chr16:88738635 [GRCh38] Chr16:88805043 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.627A>G (p.Ala209=) |
single nucleotide variant |
not provided [RCV000886239]|not specified [RCV001726362] |
Chr16:88738575 [GRCh38] Chr16:88804983 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4968C>A (p.Ile1656=) |
single nucleotide variant |
PIEZO1-related condition [RCV003895541]|not provided [RCV000910178] |
Chr16:88722054 [GRCh38] Chr16:88788462 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4356G>C (p.Val1452=) |
single nucleotide variant |
not provided [RCV000881970] |
Chr16:88723308 [GRCh38] Chr16:88789716 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.998G>A (p.Arg333His) |
single nucleotide variant |
not provided [RCV000959332]|not specified [RCV001701263] |
Chr16:88737956 [GRCh38] Chr16:88804364 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5238G>A (p.Leu1746=) |
single nucleotide variant |
not provided [RCV000897105] |
Chr16:88721703 [GRCh38] Chr16:88788111 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5404-9G>A |
single nucleotide variant |
not provided [RCV000926181] |
Chr16:88721439 [GRCh38] Chr16:88787847 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5976G>A (p.Thr1992=) |
single nucleotide variant |
not provided [RCV000915386] |
Chr16:88720257 [GRCh38] Chr16:88786665 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7353C>T (p.Ile2451=) |
single nucleotide variant |
PIEZO1-related condition [RCV003950817]|not provided [RCV000915435] |
Chr16:88715818 [GRCh38] Chr16:88782226 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2952G>A (p.Lys984=) |
single nucleotide variant |
not provided [RCV000976040] |
Chr16:88732374 [GRCh38] Chr16:88798782 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7495T>C (p.Leu2499=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002487967]|not provided [RCV000901743] |
Chr16:88715676 [GRCh38] Chr16:88782084 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4955+3G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002505306]|not provided [RCV000901744] |
Chr16:88722215 [GRCh38] Chr16:88788623 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4872A>G (p.Ala1624=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002502663]|not provided [RCV000901745] |
Chr16:88722301 [GRCh38] Chr16:88788709 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3935C>T (p.Ala1312Val) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003992420]|not provided [RCV000901746] |
Chr16:88726317 [GRCh38] Chr16:88792725 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2664+7del |
deletion |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002502664]|not provided [RCV000901747] |
Chr16:88733271 [GRCh38] Chr16:88799679 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5052C>T (p.Ala1684=) |
single nucleotide variant |
not provided [RCV000917997] |
Chr16:88721970 [GRCh38] Chr16:88788378 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3597C>T (p.Phe1199=) |
single nucleotide variant |
not provided [RCV000885629] |
Chr16:88726817 [GRCh38] Chr16:88793225 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2970C>T (p.Phe990=) |
single nucleotide variant |
not provided [RCV000930694] |
Chr16:88732356 [GRCh38] Chr16:88798764 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.849-10C>T |
single nucleotide variant |
not provided [RCV000886970] |
Chr16:88738115 [GRCh38] Chr16:88804523 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2520G>C (p.Leu840=) |
single nucleotide variant |
not provided [RCV000910305] |
Chr16:88733422 [GRCh38] Chr16:88799830 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1998-5C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003950719]|not provided [RCV000910317] |
Chr16:88734543 [GRCh38] Chr16:88800951 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4495+4C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003936164]|not provided [RCV000973214] |
Chr16:88723091 [GRCh38] Chr16:88789499 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3426C>G (p.Pro1142=) |
single nucleotide variant |
not provided [RCV000885686] |
Chr16:88727068 [GRCh38] Chr16:88793476 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4775+8C>T |
single nucleotide variant |
not provided [RCV000931382] |
Chr16:88722575 [GRCh38] Chr16:88788983 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3153C>T (p.Tyr1051=) |
single nucleotide variant |
PIEZO1-related condition [RCV003895539]|not provided [RCV000909518] |
Chr16:88731749 [GRCh38] Chr16:88798157 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5871C>T (p.Ala1957=) |
single nucleotide variant |
not provided [RCV000933424] |
Chr16:88720463 [GRCh38] Chr16:88786871 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1767C>T (p.Ile589=) |
single nucleotide variant |
not provided [RCV000921313] |
Chr16:88734956 [GRCh38] Chr16:88801364 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5226C>T (p.Val1742=) |
single nucleotide variant |
not provided [RCV000917815] |
Chr16:88721715 [GRCh38] Chr16:88788123 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.132C>T (p.Phe44=) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002495342]|not provided [RCV000880697] |
Chr16:88749412 [GRCh38] Chr16:88815820 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7314C>T (p.Tyr2438=) |
single nucleotide variant |
PIEZO1-related condition [RCV003970458]|not provided [RCV000918000] |
Chr16:88715935 [GRCh38] Chr16:88782343 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.675G>T (p.Leu225=) |
single nucleotide variant |
not provided [RCV000918017] |
Chr16:88738400 [GRCh38] Chr16:88804808 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6144C>T (p.Ile2048=) |
single nucleotide variant |
PIEZO1-related condition [RCV003970582]|not provided [RCV000933062] |
Chr16:88720089 [GRCh38] Chr16:88786497 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1306A>T (p.Ile436Phe) |
single nucleotide variant |
not provided [RCV001239412] |
Chr16:88736399 [GRCh38] Chr16:88802807 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5773C>T (p.Arg1925Trp) |
single nucleotide variant |
Lymphatic malformation 6 [RCV001250670]|not provided [RCV001812261] |
Chr16:88720644 [GRCh38] Chr16:88787052 [GRCh37] Chr16:16q24.3 |
pathogenic|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2554C>G (p.Pro852Ala) |
single nucleotide variant |
not provided [RCV001236586] |
Chr16:88733388 [GRCh38] Chr16:88799796 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4453C>T (p.Gln1485Ter) |
single nucleotide variant |
not provided [RCV001236587] |
Chr16:88723137 [GRCh38] Chr16:88789545 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3282C>T (p.Pro1094=) |
single nucleotide variant |
not provided [RCV000911927] |
Chr16:88727576 [GRCh38] Chr16:88793984 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1723G>A (p.Val575Met) |
single nucleotide variant |
not provided [RCV000957490] |
Chr16:88735000 [GRCh38] Chr16:88801408 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.263A>G (p.Asp88Gly) |
single nucleotide variant |
not provided [RCV000957491] |
Chr16:88742320 [GRCh38] Chr16:88808728 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4887G>C (p.Gly1629=) |
single nucleotide variant |
not provided [RCV000913220] |
Chr16:88722286 [GRCh38] Chr16:88788694 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4866G>A (p.Glu1622=) |
single nucleotide variant |
not provided [RCV000890217] |
Chr16:88722307 [GRCh38] Chr16:88788715 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6936G>T (p.Ala2312=) |
single nucleotide variant |
not provided [RCV000912127] |
Chr16:88716474 [GRCh38] Chr16:88782882 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5214+7C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003970372]|not provided [RCV000912152] |
Chr16:88721801 [GRCh38] Chr16:88788209 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6303C>T (p.Leu2101=) |
single nucleotide variant |
not provided [RCV000913491] |
Chr16:88719822 [GRCh38] Chr16:88786230 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1196-6C>T |
single nucleotide variant |
not provided [RCV000891412] |
Chr16:88736745 [GRCh38] Chr16:88803153 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2823C>T (p.Phe941=) |
single nucleotide variant |
not provided [RCV000913510] |
Chr16:88732503 [GRCh38] Chr16:88798911 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4102C>A (p.Arg1368=) |
single nucleotide variant |
not provided [RCV000911244] |
Chr16:88725476 [GRCh38] Chr16:88791884 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2316G>C (p.Thr772=) |
single nucleotide variant |
not provided [RCV000913427] |
Chr16:88733919 [GRCh38] Chr16:88800327 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7419C>T (p.Cys2473=) |
single nucleotide variant |
not provided [RCV000913963] |
Chr16:88715752 [GRCh38] Chr16:88782160 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4813G>A (p.Asp1605Asn) |
single nucleotide variant |
PIEZO1-related condition [RCV003913034]|not provided [RCV000912634] |
Chr16:88722360 [GRCh38] Chr16:88788768 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7152C>T (p.Gly2384=) |
single nucleotide variant |
not provided [RCV000957487] |
Chr16:88716097 [GRCh38] Chr16:88782505 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6222C>T (p.Phe2074=) |
single nucleotide variant |
not provided [RCV000957488] |
Chr16:88719903 [GRCh38] Chr16:88786311 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4475G>A (p.Gly1492Asp) |
single nucleotide variant |
not provided [RCV000957489] |
Chr16:88723115 [GRCh38] Chr16:88789523 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.705C>T (p.Ala235=) |
single nucleotide variant |
not provided [RCV000891210] |
Chr16:88738370 [GRCh38] Chr16:88804778 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.429A>T (p.Ala143=) |
single nucleotide variant |
PIEZO1-related condition [RCV003923183]|not provided [RCV000912490] |
Chr16:88741514 [GRCh38] Chr16:88807922 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4728G>A (p.Thr1576=) |
single nucleotide variant |
not provided [RCV000890831] |
Chr16:88722630 [GRCh38] Chr16:88789038 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2992-200C>G |
single nucleotide variant |
not provided [RCV001677253] |
Chr16:88732110 [GRCh38] Chr16:88798518 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+141CGCA[2] |
microsatellite |
not provided [RCV001563062] |
Chr16:88727401..88727408 [GRCh38] Chr16:88793809..88793816 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001012759.3(CTU2):c.*132A>C |
single nucleotide variant |
not provided [RCV001661131] |
Chr16:88715383 [GRCh38] Chr16:88781791 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466-92C>T |
single nucleotide variant |
not provided [RCV001657558] |
Chr16:88738828 [GRCh38] Chr16:88805236 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3198T>A (p.Asp1066Glu) |
single nucleotide variant |
Hemolytic anemia [RCV003234640] |
Chr16:88727660 [GRCh38] Chr16:88794068 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.848+59G>A |
single nucleotide variant |
not provided [RCV001558821] |
Chr16:88738168 [GRCh38] Chr16:88804576 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4335+132C>A |
single nucleotide variant |
not provided [RCV001595761] |
Chr16:88723739 [GRCh38] Chr16:88790147 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3796+22G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788795]|Lymphatic malformation 6 [RCV001788796]|not provided [RCV001693632] |
Chr16:88726525 [GRCh38] Chr16:88792933 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.327-147A>G |
single nucleotide variant |
not provided [RCV001555256] |
Chr16:88741763 [GRCh38] Chr16:88808171 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2991+143G>A |
single nucleotide variant |
not provided [RCV001560738] |
Chr16:88732192 [GRCh38] Chr16:88798600 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.465+278T>C |
single nucleotide variant |
not provided [RCV001636226] |
Chr16:88741200 [GRCh38] Chr16:88807608 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4955+8C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003956266]|not provided [RCV001573788] |
Chr16:88722210 [GRCh38] Chr16:88788618 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2991+108G>A |
single nucleotide variant |
not provided [RCV001550590] |
Chr16:88732227 [GRCh38] Chr16:88798635 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4499G>T (p.Arg1500Leu) |
single nucleotide variant |
not provided [RCV003235907] |
Chr16:88723006 [GRCh38] Chr16:88789414 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5464G>A (p.Glu1822Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004039419]|not provided [RCV001573905] |
Chr16:88721370 [GRCh38] Chr16:88787778 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.1582C>T (p.Leu528Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV003276404] |
Chr16:88735222 [GRCh38] Chr16:88801630 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88697181-88809407)x1 |
copy number loss |
not provided [RCV002473721] |
Chr16:88697181..88809407 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6280C>T (p.Leu2094Phe) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001263246] |
Chr16:88719845 [GRCh38] Chr16:88786253 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1557+62C>T |
single nucleotide variant |
not provided [RCV001540995] |
Chr16:88736086 [GRCh38] Chr16:88802494 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.160+130dup |
duplication |
not provided [RCV001593344] |
Chr16:88749239..88749240 [GRCh38] Chr16:88815647..88815648 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001012759.3(CTU2):c.1419+52_1419+54dup |
duplication |
not provided [RCV001688133] |
Chr16:88714976..88714977 [GRCh38] Chr16:88781384..88781385 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4955+65A>G |
single nucleotide variant |
not provided [RCV001674346] |
Chr16:88722153 [GRCh38] Chr16:88788561 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1195+36dup |
duplication |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788696]|Lymphatic malformation 6 [RCV001788697]|not provided [RCV001655421] |
Chr16:88737517..88737518 [GRCh38] Chr16:88803925..88803926 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4775+57T>C |
single nucleotide variant |
not provided [RCV001659412] |
Chr16:88722526 [GRCh38] Chr16:88788934 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1557+83G>A |
single nucleotide variant |
not provided [RCV001659475] |
Chr16:88736065 [GRCh38] Chr16:88802473 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4853G>A (p.Arg1618His) |
single nucleotide variant |
Inborn genetic diseases [RCV002592495]|not provided [RCV001594059] |
Chr16:88722320 [GRCh38] Chr16:88788728 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3301+171T>G |
single nucleotide variant |
not provided [RCV001597684] |
Chr16:88727386 [GRCh38] Chr16:88793794 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466-39C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788810]|Lymphatic malformation 6 [RCV001788811]|not provided [RCV001689255] |
Chr16:88738775 [GRCh38] Chr16:88805183 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4956-61A>G |
single nucleotide variant |
not provided [RCV001715012] |
Chr16:88722127 [GRCh38] Chr16:88788535 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3968+101G>C |
single nucleotide variant |
not provided [RCV001582017] |
Chr16:88726183 [GRCh38] Chr16:88792591 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2665-98A>G |
single nucleotide variant |
not provided [RCV001656240] |
Chr16:88732830 [GRCh38] Chr16:88799238 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6660+57T>C |
single nucleotide variant |
not provided [RCV001650115] |
Chr16:88716966 [GRCh38] Chr16:88783374 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.-187T>A |
single nucleotide variant |
not provided [RCV001649482] |
Chr16:88785151 [GRCh38] Chr16:88851559 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.465+101C>T |
single nucleotide variant |
not provided [RCV001620451] |
Chr16:88741377 [GRCh38] Chr16:88807785 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-88G>T |
single nucleotide variant |
not provided [RCV001686840] |
Chr16:88742510 [GRCh38] Chr16:88808918 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-193G>C |
single nucleotide variant |
not provided [RCV001637661] |
Chr16:88742615 [GRCh38] Chr16:88809023 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.-165G>A |
single nucleotide variant |
not provided [RCV001598611] |
Chr16:88785129 [GRCh38] Chr16:88851537 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3699+33T>C |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788642]|Lymphatic malformation 6 [RCV001788643]|not provided [RCV001617908] |
Chr16:88726682 [GRCh38] Chr16:88793090 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.65-154A>G |
single nucleotide variant |
not provided [RCV001653420] |
Chr16:88749633 [GRCh38] Chr16:88816041 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3197-136C>G |
single nucleotide variant |
not provided [RCV001618097] |
Chr16:88727797 [GRCh38] Chr16:88794205 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.65-39C>T |
single nucleotide variant |
not provided [RCV001588476] |
Chr16:88749518 [GRCh38] Chr16:88815926 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2992-46_2992-45insCAT |
insertion |
not provided [RCV001594308] |
Chr16:88731955..88731956 [GRCh38] Chr16:88798363..88798364 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3196+132C>G |
single nucleotide variant |
not provided [RCV001638548] |
Chr16:88731574 [GRCh38] Chr16:88797982 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7316+21del |
deletion |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788659]|Lymphatic malformation 6 [RCV001788660]|not provided [RCV001636356] |
Chr16:88715912 [GRCh38] Chr16:88782320 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2488-34_2488-3del |
microsatellite |
not provided [RCV003546609]|not specified [RCV001001051] |
Chr16:88733457..88733488 [GRCh38] Chr16:88799865..88799896 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5822C>T (p.Pro1941Leu) |
single nucleotide variant |
not specified [RCV001001180] |
Chr16:88720512 [GRCh38] Chr16:88786920 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5515G>A (p.Glu1839Lys) |
single nucleotide variant |
not provided [RCV001811603] |
Chr16:88721319 [GRCh38] Chr16:88787727 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2330-16C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002489507]|not provided [RCV001811614] |
Chr16:88733761 [GRCh38] Chr16:88800169 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1196-17G>A |
single nucleotide variant |
not provided [RCV001724286] |
Chr16:88736756 [GRCh38] Chr16:88803164 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5668+186G>A |
single nucleotide variant |
not provided [RCV001694342] |
Chr16:88720980 [GRCh38] Chr16:88787388 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+179A>G |
single nucleotide variant |
not provided [RCV001694344] |
Chr16:88727378 [GRCh38] Chr16:88793786 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4775+53C>T |
single nucleotide variant |
not provided [RCV001611951] |
Chr16:88722530 [GRCh38] Chr16:88788938 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6705C>T (p.Phe2235=) |
single nucleotide variant |
PIEZO1-related condition [RCV003953421]|not provided [RCV003736955]|not specified [RCV001001144] |
Chr16:88716854 [GRCh38] Chr16:88783262 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4234+18G>A |
single nucleotide variant |
not specified [RCV001001165] |
Chr16:88724991 [GRCh38] Chr16:88791399 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6205G>A (p.Val2069Met) |
single nucleotide variant |
not provided [RCV001509524] |
Chr16:88719920 [GRCh38] Chr16:88786328 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3602C>T (p.Thr1201Met) |
single nucleotide variant |
not provided [RCV001464424]|not specified [RCV001002143] |
Chr16:88726812 [GRCh38] Chr16:88793220 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5615G>A (p.Arg1872His) |
single nucleotide variant |
Inborn genetic diseases [RCV004030270]|not provided [RCV003130097]|not specified [RCV001002354] |
Chr16:88721219 [GRCh38] Chr16:88787627 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.64+12G>T |
single nucleotide variant |
not specified [RCV001002559] |
Chr16:88784889 [GRCh38] Chr16:88851297 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2330-23C>A |
single nucleotide variant |
not provided [RCV001667946] |
Chr16:88733768 [GRCh38] Chr16:88800176 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.327-117A>G |
single nucleotide variant |
not provided [RCV001678784] |
Chr16:88741733 [GRCh38] Chr16:88808141 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+152A>G |
single nucleotide variant |
not provided [RCV001645932] |
Chr16:88727405 [GRCh38] Chr16:88793813 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4775+31G>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788682]|Lymphatic malformation 6 [RCV001788683]|not provided [RCV001652047] |
Chr16:88722552 [GRCh38] Chr16:88788960 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4234+188_4234+189del |
microsatellite |
not provided [RCV001644512] |
Chr16:88724820..88724821 [GRCh38] Chr16:88791228..88791229 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2180+71G>A |
single nucleotide variant |
not provided [RCV001648875] |
Chr16:88734285 [GRCh38] Chr16:88800693 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2181-139A>G |
single nucleotide variant |
not provided [RCV001693191] |
Chr16:88734193 [GRCh38] Chr16:88800601 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-275T>A |
single nucleotide variant |
not provided [RCV001616254] |
Chr16:88742697 [GRCh38] Chr16:88809105 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-211G>C |
single nucleotide variant |
not provided [RCV001667306] |
Chr16:88742633 [GRCh38] Chr16:88809041 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+107G>A |
single nucleotide variant |
not provided [RCV001649091] |
Chr16:88727450 [GRCh38] Chr16:88793858 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1557+45C>A |
single nucleotide variant |
not provided [RCV001694313] |
Chr16:88736103 [GRCh38] Chr16:88802511 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466-112G>T |
single nucleotide variant |
not provided [RCV001641367] |
Chr16:88738848 [GRCh38] Chr16:88805256 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1195+33T>G |
single nucleotide variant |
not provided [RCV001611298] |
Chr16:88737526 [GRCh38] Chr16:88803934 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3197-244C>T |
single nucleotide variant |
not provided [RCV001536800] |
Chr16:88727905 [GRCh38] Chr16:88794313 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5802-27G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788721]|Lymphatic malformation 6 [RCV001788722]|not provided [RCV001668782] |
Chr16:88720559 [GRCh38] Chr16:88786967 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4969C>T (p.Pro1657Ser) |
single nucleotide variant |
not provided [RCV001573353] |
Chr16:88722053 [GRCh38] Chr16:88788461 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2247GGA[9] (p.Glu756dup) |
microsatellite |
not provided [RCV001573362]|not specified [RCV001700786] |
Chr16:88733964..88733965 [GRCh38] Chr16:88800372..88800373 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2664+269C>G |
single nucleotide variant |
not provided [RCV001643746] |
Chr16:88733009 [GRCh38] Chr16:88799417 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.161-42C>T |
single nucleotide variant |
not provided [RCV001679411] |
Chr16:88742464 [GRCh38] Chr16:88808872 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3197-334C>T |
single nucleotide variant |
not provided [RCV001708147] |
Chr16:88727995 [GRCh38] Chr16:88794403 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1297-14T>C |
single nucleotide variant |
not provided [RCV001583876] |
Chr16:88736422 [GRCh38] Chr16:88802830 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3302-67A>G |
single nucleotide variant |
not provided [RCV001588250] |
Chr16:88727259 [GRCh38] Chr16:88793667 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2665-148C>T |
single nucleotide variant |
not provided [RCV001691788] |
Chr16:88732880 [GRCh38] Chr16:88799288 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4668+46C>T |
single nucleotide variant |
not provided [RCV001611791] |
Chr16:88722791 [GRCh38] Chr16:88789199 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3302-32T>C |
single nucleotide variant |
not provided [RCV001612844] |
Chr16:88727224 [GRCh38] Chr16:88793632 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.465+243C>T |
single nucleotide variant |
not provided [RCV001539601] |
Chr16:88741235 [GRCh38] Chr16:88807643 [GRCh37] Chr16:16q24.3 |
benign |
GRCh37/hg19 16q21-24.3(chr16:61524229-90155062)x3 |
copy number gain |
not provided [RCV001249359] |
Chr16:61524229..90155062 [GRCh37] Chr16:16q21-24.3 |
not provided |
NM_001142864.4(PIEZO1):c.4404_4405insAGCAGG (p.Ala1469_Arg1470insSerArg) |
insertion |
none provided [RCV001000428] |
Chr16:88723259..88723260 [GRCh38] Chr16:88789667..88789668 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3456-11C>T |
single nucleotide variant |
not provided [RCV001574048]|not specified [RCV001700965] |
Chr16:88726969 [GRCh38] Chr16:88793377 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1051C>T (p.Arg351Trp) |
single nucleotide variant |
not provided [RCV002551694]|not specified [RCV001002399] |
Chr16:88737784 [GRCh38] Chr16:88804192 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1447G>A (p.Val483Met) |
single nucleotide variant |
not provided [RCV002549187]|not specified [RCV001002651] |
Chr16:88736258 [GRCh38] Chr16:88802666 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.1591C>T (p.Arg531Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002549154]|not provided [RCV001811589] |
Chr16:88735213 [GRCh38] Chr16:88801621 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6288G>A (p.Lys2096=) |
single nucleotide variant |
not provided [RCV001673000] |
Chr16:88719837 [GRCh38] Chr16:88786245 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5505G>A (p.Ala1835=) |
single nucleotide variant |
not provided [RCV001664607] |
Chr16:88721329 [GRCh38] Chr16:88787737 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.786C>A (p.Cys262Ter) |
single nucleotide variant |
not provided [RCV001233121] |
Chr16:88738289 [GRCh38] Chr16:88804697 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.5289C>T (p.Tyr1763=) |
single nucleotide variant |
not provided [RCV001570179] |
Chr16:88721652 [GRCh38] Chr16:88788060 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2466C>T (p.Thr822=) |
single nucleotide variant |
not provided [RCV001585906] |
Chr16:88733609 [GRCh38] Chr16:88800017 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4289A>T (p.Glu1430Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002550746]|not provided [RCV003656151] |
Chr16:88723917 [GRCh38] Chr16:88790325 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2329+11C>T |
single nucleotide variant |
not specified [RCV001001109] |
Chr16:88733895 [GRCh38] Chr16:88800303 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3700-12G>T |
single nucleotide variant |
not provided [RCV001811612] |
Chr16:88726655 [GRCh38] Chr16:88793063 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4291G>C (p.Ala1431Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002549175]|not provided [RCV003656154] |
Chr16:88723915 [GRCh38] Chr16:88790323 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4519G>C (p.Val1507Leu) |
single nucleotide variant |
Polyhydramnios [RCV001257388] |
Chr16:88722986 [GRCh38] Chr16:88789394 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4885G>A (p.Gly1629Arg) |
single nucleotide variant |
Polyhydramnios [RCV001257389]|not provided [RCV001357682] |
Chr16:88722288 [GRCh38] Chr16:88788696 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4275_4278del (p.Ser1425fs) |
deletion |
Inborn genetic diseases [RCV001266664]|Lymphatic malformation 6 [RCV003323839]|not provided [RCV001812267] |
Chr16:88723928..88723931 [GRCh38] Chr16:88790336..88790339 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7477CTGGAG[1] (p.2493LE[1]) |
microsatellite |
Inborn genetic diseases [RCV001266665] |
Chr16:88715683..88715688 [GRCh38] Chr16:88782091..88782096 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1196-353C>G |
single nucleotide variant |
not provided [RCV001641592] |
Chr16:88737092 [GRCh38] Chr16:88803500 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3340C>G (p.Gln1114Glu) |
single nucleotide variant |
Hydrops fetalis [RCV001257384]|PIEZO1-related condition [RCV003945950]|not provided [RCV002570622] |
Chr16:88727154 [GRCh38] Chr16:88793562 [GRCh37] Chr16:16q24.3 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3191G>T (p.Cys1064Phe) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001257446]|Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001729823] |
Chr16:88731711 [GRCh38] Chr16:88798119 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2416del (p.Leu806fs) |
deletion |
Xerocytosis [RCV001334826] |
Chr16:88733659 [GRCh38] Chr16:88800067 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2860C>T (p.Arg954Trp) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001262597]|not provided [RCV001812265] |
Chr16:88732466 [GRCh38] Chr16:88798874 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6070C>T (p.Arg2024Cys) |
single nucleotide variant |
not provided [RCV001810608] |
Chr16:88720163 [GRCh38] Chr16:88786571 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7184C>T (p.Ala2395Val) |
single nucleotide variant |
Hydrops fetalis [RCV001257385]|not provided [RCV003558769] |
Chr16:88716065 [GRCh38] Chr16:88782473 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.3197A>G (p.Asp1066Gly) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001257445]|Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001729822] |
Chr16:88727661 [GRCh38] Chr16:88794069 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
GRCh37/hg19 16q24.2-24.3(chr16:88222732-90155062)x3 |
copy number gain |
not provided [RCV001258663] |
Chr16:88222732..90155062 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1179_1180delinsGC (p.Val394Leu) |
indel |
not provided [RCV003084280] |
Chr16:88737574..88737575 [GRCh38] Chr16:88803982..88803983 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1020+14A>G |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001331709] |
Chr16:88737920 [GRCh38] Chr16:88804328 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5054C>T (p.Ala1685Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003246831]|not provided [RCV001812363] |
Chr16:88721968 [GRCh38] Chr16:88788376 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1540C>T (p.Leu514=) |
single nucleotide variant |
not provided [RCV001615149] |
Chr16:88736165 [GRCh38] Chr16:88802573 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.765C>T (p.Phe255=) |
single nucleotide variant |
not provided [RCV001812989] |
Chr16:88738310 [GRCh38] Chr16:88804718 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1297-16C>T |
single nucleotide variant |
not provided [RCV001713080] |
Chr16:88736424 [GRCh38] Chr16:88802832 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6375G>A (p.Val2125=) |
single nucleotide variant |
not provided [RCV001813100] |
Chr16:88719670 [GRCh38] Chr16:88786078 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7316G>A (p.Gly2439Asp) |
single nucleotide variant |
not provided [RCV001810695] |
Chr16:88715933 [GRCh38] Chr16:88782341 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1536_1537del (p.Cys513fs) |
deletion |
Thickened nuchal skin fold [RCV001257386] |
Chr16:88736168..88736169 [GRCh38] Chr16:88802576..88802577 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.4610_4617dup (p.Ser1540delinsAlaProTer) |
duplication |
Thickened nuchal skin fold [RCV001257387] |
Chr16:88722887..88722888 [GRCh38] Chr16:88789295..88789296 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6160G>C (p.Glu2054Gln) |
single nucleotide variant |
not provided [RCV001812468] |
Chr16:88720073 [GRCh38] Chr16:88786481 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3796+16G>A |
single nucleotide variant |
not provided [RCV001812911] |
Chr16:88726531 [GRCh38] Chr16:88792939 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3461A>G (p.Tyr1154Cys) |
single nucleotide variant |
PIEZO1-related condition [RCV003416150]|not provided [RCV001812913] |
Chr16:88726953 [GRCh38] Chr16:88793361 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3399C>T (p.Asp1133=) |
single nucleotide variant |
not provided [RCV001813143] |
Chr16:88727095 [GRCh38] Chr16:88793503 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7183G>A (p.Ala2395Thr) |
single nucleotide variant |
not provided [RCV001810670] |
Chr16:88716066 [GRCh38] Chr16:88782474 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7471C>T (p.Arg2491Trp) |
single nucleotide variant |
PIEZO1-related condition [RCV003953632]|not provided [RCV001508787]|not specified [RCV003493841] |
Chr16:88715700 [GRCh38] Chr16:88782108 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5291A>C (p.Glu1764Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV003166625]|not provided [RCV001573212] |
Chr16:88721650 [GRCh38] Chr16:88788058 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7553G>A (p.Arg2518His) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001331715] |
Chr16:88715618 [GRCh38] Chr16:88782026 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5777G>A (p.Arg1926Gln) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001334827] |
Chr16:88720640 [GRCh38] Chr16:88787048 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2815C>A (p.Leu939Met) |
single nucleotide variant |
not provided [RCV001507358] |
Chr16:88732511 [GRCh38] Chr16:88798919 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.65-17C>G |
single nucleotide variant |
not provided [RCV001810648] |
Chr16:88749496 [GRCh38] Chr16:88815904 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5833TTC[1] (p.Phe1946del) |
microsatellite |
not provided [RCV001810705] |
Chr16:88720496..88720498 [GRCh38] Chr16:88786904..88786906 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2181-15C>T |
single nucleotide variant |
not provided [RCV001539617] |
Chr16:88734069 [GRCh38] Chr16:88800477 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7099G>A (p.Glu2367Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004036704]|not provided [RCV001354355] |
Chr16:88716228 [GRCh38] Chr16:88782636 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5295C>G (p.Asn1765Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV003264002]|not provided [RCV001355566] |
Chr16:88721646 [GRCh38] Chr16:88788054 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1159G>T (p.Glu387Ter) |
single nucleotide variant |
Xerocytosis [RCV001331710] |
Chr16:88737595 [GRCh38] Chr16:88804003 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.849-5G>A |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001331716] |
Chr16:88738110 [GRCh38] Chr16:88804518 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.*163G>A |
single nucleotide variant |
not provided [RCV001642152] |
Chr16:88715442 [GRCh38] Chr16:88781850 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1543G>A (p.Asp515Asn) |
single nucleotide variant |
not provided [RCV001812373] |
Chr16:88736162 [GRCh38] Chr16:88802570 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2860C>A (p.Arg954=) |
single nucleotide variant |
not provided [RCV001813097] |
Chr16:88732466 [GRCh38] Chr16:88798874 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3699+20G>C |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788455]|Lymphatic malformation 6 [RCV001788456]|not provided [RCV001655712] |
Chr16:88726695 [GRCh38] Chr16:88793103 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7374C>G (p.Phe2458Leu) |
single nucleotide variant |
not provided [RCV001508788] |
Chr16:88715797 [GRCh38] Chr16:88782205 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.881C>T (p.Thr294Ile) |
single nucleotide variant |
not provided [RCV001810626] |
Chr16:88738073 [GRCh38] Chr16:88804481 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2992-13_2992-12insCCCCAGACTCAGTGCATCCCCACACCCCGCCCTCCCCCCAGACTCAGTGCATCCCCACACCCCCCCCTCCCTCCAGACTCAGTGCATCCCCACGCCCCGCCCTC |
insertion |
none provided [RCV001285588] |
Chr16:88731922..88731923 [GRCh38] Chr16:88798330..88798331 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.848+17C>T |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788453]|Lymphatic malformation 6 [RCV001788454]|not provided [RCV001692369] |
Chr16:88738210 [GRCh38] Chr16:88804618 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3196+19G>T |
single nucleotide variant |
not provided [RCV001812284] |
Chr16:88731687 [GRCh38] Chr16:88798095 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5937C>G (p.Phe1979Leu) |
single nucleotide variant |
not provided [RCV001357505] |
Chr16:88720397 [GRCh38] Chr16:88786805 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4850C>T (p.Thr1617Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001269332]|not provided [RCV001812270] |
Chr16:88722323 [GRCh38] Chr16:88788731 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5790C>G (p.Phe1930Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001335707]|Inborn genetic diseases [RCV004035794]|PIEZO1-related condition [RCV003973209]|not provided [RCV001509528] |
Chr16:88720627 [GRCh38] Chr16:88787035 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6058_6059del (p.Ala2020fs) |
microsatellite |
Xerocytosis [RCV001335708] |
Chr16:88720174..88720175 [GRCh38] Chr16:88786582..88786583 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4007T>C (p.Ile1336Thr) |
single nucleotide variant |
not provided [RCV001812492] |
Chr16:88725646 [GRCh38] Chr16:88792054 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.749_750delinsCT (p.Val250Ala) |
indel |
none provided [RCV001286000] |
Chr16:88738325..88738326 [GRCh38] Chr16:88804733..88804734 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4163-3C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003973181]|not provided [RCV001812478] |
Chr16:88725083 [GRCh38] Chr16:88791491 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3778G>A (p.Val1260Ile) |
single nucleotide variant |
not provided [RCV001812954] |
Chr16:88726565 [GRCh38] Chr16:88792973 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.146G>A (p.Arg49Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002541774]|not provided [RCV001812971] |
Chr16:88749398 [GRCh38] Chr16:88815806 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2164C>A (p.Pro722Thr) |
single nucleotide variant |
not provided [RCV001812986] |
Chr16:88734372 [GRCh38] Chr16:88800780 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1557+16C>G |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788451]|Lymphatic malformation 6 [RCV001788452]|not provided [RCV001530900] |
Chr16:88736132 [GRCh38] Chr16:88802540 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1107+1G>C |
single nucleotide variant |
PIEZO1-related condition [RCV003399236]|not provided [RCV003130520]|not specified [RCV001449719] |
Chr16:88737727 [GRCh38] Chr16:88804135 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5290G>C (p.Glu1764Gln) |
single nucleotide variant |
not provided [RCV001356729] |
Chr16:88721651 [GRCh38] Chr16:88788059 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2745C>G (p.Asn915Lys) |
single nucleotide variant |
not provided [RCV001507360] |
Chr16:88732652 [GRCh38] Chr16:88799060 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2215G>C (p.Glu739Gln) |
single nucleotide variant |
not provided [RCV001507363] |
Chr16:88734020 [GRCh38] Chr16:88800428 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1558-12C>T |
single nucleotide variant |
not provided [RCV001507368] |
Chr16:88735258 [GRCh38] Chr16:88801666 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1297-4G>A |
single nucleotide variant |
not provided [RCV001507370] |
Chr16:88736412 [GRCh38] Chr16:88802820 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1970G>A (p.Arg657His) |
single nucleotide variant |
not provided [RCV001356118] |
Chr16:88734677 [GRCh38] Chr16:88801085 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3395C>G (p.Thr1132Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002548526]|not provided [RCV001358341] |
Chr16:88727099 [GRCh38] Chr16:88793507 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4058+29G>A |
single nucleotide variant |
not provided [RCV001508418] |
Chr16:88725566 [GRCh38] Chr16:88791974 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3410C>T (p.Pro1137Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002567991]|not provided [RCV001508425] |
Chr16:88727084 [GRCh38] Chr16:88793492 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1069G>C (p.Glu357Gln) |
single nucleotide variant |
not provided [RCV001507371] |
Chr16:88737766 [GRCh38] Chr16:88804174 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.335T>C (p.Leu112Pro) |
single nucleotide variant |
not provided [RCV001508796] |
Chr16:88741608 [GRCh38] Chr16:88808016 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4027G>A (p.Glu1343Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002564242]|not provided [RCV001508419] |
Chr16:88725626 [GRCh38] Chr16:88792034 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2842C>T (p.Arg948Cys) |
single nucleotide variant |
not provided [RCV001508428] |
Chr16:88732484 [GRCh38] Chr16:88798892 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7174G>A (p.Glu2392Lys) |
single nucleotide variant |
Blood group, ER [RCV003152632]|ER BLOOD GROUP SYSTEM, ER(a-b-) [RCV003152633]|Inborn genetic diseases [RCV002567998]|PIEZO1-related condition [RCV003394083]|not provided [RCV001508790] |
Chr16:88716075 [GRCh38] Chr16:88782483 [GRCh37] Chr16:16q24.3 |
pathogenic|affects|uncertain significance |
NM_001142864.4(PIEZO1):c.5802-4G>C |
single nucleotide variant |
not provided [RCV001509527] |
Chr16:88720536 [GRCh38] Chr16:88786944 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2610G>A (p.Met870Ile) |
single nucleotide variant |
Non-immune hydrops fetalis [RCV001376056]|not provided [RCV001865886] |
Chr16:88733332 [GRCh38] Chr16:88799740 [GRCh37] Chr16:16q24.3 |
likely pathogenic|uncertain significance |
NM_001142864.4(PIEZO1):c.4435A>C (p.Thr1479Pro) |
single nucleotide variant |
not provided [RCV001485235] |
Chr16:88723229 [GRCh38] Chr16:88789637 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2180+94C>G |
single nucleotide variant |
not provided [RCV001536631] |
Chr16:88734262 [GRCh38] Chr16:88800670 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1357A>C (p.Ile453Leu) |
single nucleotide variant |
not provided [RCV001439483] |
Chr16:88736348 [GRCh38] Chr16:88802756 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.3301+55G>A |
single nucleotide variant |
not provided [RCV001541038] |
Chr16:88727502 [GRCh38] Chr16:88793910 [GRCh37] Chr16:16q24.3 |
benign |
NC_000016.9:g.(?_88709737)_(89220635_?)del |
deletion |
Granulomatous disease, chronic, autosomal recessive, cytochrome b-negative [RCV001388209] |
Chr16:88709737..89220635 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.1792G>A (p.Val598Met) |
single nucleotide variant |
Non-immune hydrops fetalis [RCV001375989]|not provided [RCV001780276] |
Chr16:88734931 [GRCh38] Chr16:88801339 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1537del (p.Cys513fs) |
deletion |
not provided [RCV001380953] |
Chr16:88736168 [GRCh38] Chr16:88802576 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.326+200A>G |
single nucleotide variant |
not provided [RCV001527772] |
Chr16:88741853 [GRCh38] Chr16:88808261 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3437C>T (p.Pro1146Leu) |
single nucleotide variant |
not provided [RCV001508424] |
Chr16:88727057 [GRCh38] Chr16:88793465 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3455+18C>G |
single nucleotide variant |
not provided [RCV001508423] |
Chr16:88727021 [GRCh38] Chr16:88793429 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2992-18G>A |
single nucleotide variant |
not provided [RCV001508426] |
Chr16:88731928 [GRCh38] Chr16:88798336 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7180G>A (p.Gly2394Ser) |
single nucleotide variant |
Blood group, ER [RCV003152631]|not provided [RCV001508789] |
Chr16:88716069 [GRCh38] Chr16:88782477 [GRCh37] Chr16:16q24.3 |
affects|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6943G>C (p.Gly2315Arg) |
single nucleotide variant |
not provided [RCV001508793] |
Chr16:88716467 [GRCh38] Chr16:88782875 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.848+6G>C |
single nucleotide variant |
not provided [RCV001508795] |
Chr16:88738221 [GRCh38] Chr16:88804629 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4720G>A (p.Glu1574Lys) |
single nucleotide variant |
not provided [RCV001508416] |
Chr16:88722638 [GRCh38] Chr16:88789046 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3796+21C>G |
single nucleotide variant |
not provided [RCV001508421] |
Chr16:88726526 [GRCh38] Chr16:88792934 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3700-14C>T |
single nucleotide variant |
not provided [RCV001508422] |
Chr16:88726657 [GRCh38] Chr16:88793065 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1557+308C>T |
single nucleotide variant |
not provided [RCV001666587] |
Chr16:88735840 [GRCh38] Chr16:88802248 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6796G>A (p.Val2266Ile) |
single nucleotide variant |
not provided [RCV001509522] |
Chr16:88716689 [GRCh38] Chr16:88783097 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6754-14T>C |
single nucleotide variant |
not provided [RCV001509523] |
Chr16:88716745 [GRCh38] Chr16:88783153 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.465+24G>A |
single nucleotide variant |
not provided [RCV001694946] |
Chr16:88741454 [GRCh38] Chr16:88807862 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1015G>T (p.Gly339Cys) |
single nucleotide variant |
not provided [RCV001508794] |
Chr16:88737939 [GRCh38] Chr16:88804347 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2991+118G>A |
single nucleotide variant |
not provided [RCV001670931] |
Chr16:88732217 [GRCh38] Chr16:88798625 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2991+141C>T |
single nucleotide variant |
not provided [RCV001695058] |
Chr16:88732194 [GRCh38] Chr16:88798602 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1558-116C>T |
single nucleotide variant |
not provided [RCV001654198] |
Chr16:88735362 [GRCh38] Chr16:88801770 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2664+202A>C |
single nucleotide variant |
not provided [RCV001643342] |
Chr16:88733076 [GRCh38] Chr16:88799484 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+154G>A |
single nucleotide variant |
not provided [RCV001688456] |
Chr16:88727403 [GRCh38] Chr16:88793811 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+122G>A |
single nucleotide variant |
not provided [RCV001619214] |
Chr16:88727435 [GRCh38] Chr16:88793843 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466-87C>T |
single nucleotide variant |
not provided [RCV001615697] |
Chr16:88738823 [GRCh38] Chr16:88805231 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3797-32G>C |
single nucleotide variant |
not provided [RCV001691598] |
Chr16:88726487 [GRCh38] Chr16:88792895 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4234+156T>C |
single nucleotide variant |
not provided [RCV001652010] |
Chr16:88724853 [GRCh38] Chr16:88791261 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4162+61C>T |
single nucleotide variant |
not provided [RCV001696134] |
Chr16:88725355 [GRCh38] Chr16:88791763 [GRCh37] Chr16:16q24.3 |
benign |
NM_001012759.3(CTU2):c.1479-32G>A |
single nucleotide variant |
not provided [RCV001653382] |
Chr16:88715150 [GRCh38] Chr16:88781558 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4162+127A>G |
single nucleotide variant |
not provided [RCV001611691] |
Chr16:88725289 [GRCh38] Chr16:88791697 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3700-35GCCCCGCTG[3] |
microsatellite |
not provided [RCV001715914] |
Chr16:88726660..88726661 [GRCh38] Chr16:88793068..88793069 [GRCh37] Chr16:16q24.3 |
benign |
NM_001012759.3(CTU2):c.1419+50_1419+51insTGT |
insertion |
not provided [RCV001678616] |
Chr16:88714976..88714977 [GRCh38] Chr16:88781384..88781385 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5557G>A (p.Gly1853Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV002564153]|not provided [RCV001498402] |
Chr16:88721277 [GRCh38] Chr16:88787685 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2181-148C>A |
single nucleotide variant |
not provided [RCV001708749] |
Chr16:88734202 [GRCh38] Chr16:88800610 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3301+142G>A |
single nucleotide variant |
not provided [RCV001716882] |
Chr16:88727415 [GRCh38] Chr16:88793823 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.634+51del |
deletion |
not provided [RCV001710705] |
Chr16:88738517 [GRCh38] Chr16:88804925 [GRCh37] Chr16:16q24.3 |
benign |
NM_001012759.3(CTU2):c.1503G>C (p.Arg501=) |
single nucleotide variant |
Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome [RCV001661326]|not provided [RCV001673230] |
Chr16:88715206 [GRCh38] Chr16:88781614 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2991+185A>G |
single nucleotide variant |
not provided [RCV001540865] |
Chr16:88732150 [GRCh38] Chr16:88798558 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6922C>G (p.Gln2308Glu) |
single nucleotide variant |
not provided [RCV001509520] |
Chr16:88716563 [GRCh38] Chr16:88782971 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6836G>A (p.Arg2279His) |
single nucleotide variant |
not provided [RCV001509521] |
Chr16:88716649 [GRCh38] Chr16:88783057 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5858A>C (p.Lys1953Thr) |
single nucleotide variant |
not provided [RCV001509526] |
Chr16:88720476 [GRCh38] Chr16:88786884 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5289C>G (p.Tyr1763Ter) |
single nucleotide variant |
ER BLOOD GROUP SYSTEM, ER(a-b-) [RCV003152634]|Lymphatic malformation 6 [RCV003147633]|not provided [RCV001509530] |
Chr16:88721652 [GRCh38] Chr16:88788060 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.4(PIEZO1):c.5768C>T (p.Ala1923Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002564300]|not provided [RCV001509529] |
Chr16:88720649 [GRCh38] Chr16:88787057 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7363G>A (p.Val2455Met) |
single nucleotide variant |
not provided [RCV001481873] |
Chr16:88715808 [GRCh38] Chr16:88782216 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5716_5738del (p.Pro1906fs) |
deletion |
Non-immune hydrops fetalis [RCV001376012] |
Chr16:88720679..88720701 [GRCh38] Chr16:88787087..88787109 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6809T>C (p.Ile2270Thr) |
single nucleotide variant |
Non-immune hydrops fetalis [RCV001376013]|PIEZO1-related condition [RCV003908553] |
Chr16:88716676 [GRCh38] Chr16:88783084 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2744A>G (p.Asn915Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003264047]|not provided [RCV001507361] |
Chr16:88732653 [GRCh38] Chr16:88799061 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2132T>C (p.Met711Thr) |
single nucleotide variant |
not provided [RCV001507365] |
Chr16:88734404 [GRCh38] Chr16:88800812 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1504C>T (p.Arg502Cys) |
single nucleotide variant |
not provided [RCV001507369] |
Chr16:88736201 [GRCh38] Chr16:88802609 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3969-159A>C |
single nucleotide variant |
not provided [RCV001536525] |
Chr16:88725843 [GRCh38] Chr16:88792251 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.161-203G>A |
single nucleotide variant |
not provided [RCV001538785] |
Chr16:88742625 [GRCh38] Chr16:88809033 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.623_626del (p.Leu208fs) |
deletion |
not provided [RCV001384436] |
Chr16:88738576..88738579 [GRCh38] Chr16:88804984..88804987 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4379GGC[1] (p.Arg1461_Arg1462del) |
microsatellite |
not provided [RCV001508417] |
Chr16:88723277..88723282 [GRCh38] Chr16:88789685..88789690 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3796+21_3796+22delinsTA |
indel |
not provided [RCV001508420] |
Chr16:88726525..88726526 [GRCh38] Chr16:88792933..88792934 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2879C>T (p.Pro960Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004037888]|not provided [RCV001508427] |
Chr16:88732447 [GRCh38] Chr16:88798855 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7501G>A (p.Ala2501Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002564260]|not provided [RCV001508786] |
Chr16:88715670 [GRCh38] Chr16:88782078 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7153G>A (p.Val2385Met) |
single nucleotide variant |
not provided [RCV001508791] |
Chr16:88716096 [GRCh38] Chr16:88782504 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7000G>A (p.Ala2334Thr) |
single nucleotide variant |
not provided [RCV001508792] |
Chr16:88716410 [GRCh38] Chr16:88782818 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2043C>G (p.Phe681Leu) |
single nucleotide variant |
not provided [RCV001727006] |
Chr16:88734493 [GRCh38] Chr16:88800901 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NC_000016.10:g.88779266_88827672del |
deletion |
Mucopolysaccharidosis, MPS-IV-A [RCV001578467] |
Chr16:88779266..88827672 [GRCh38] Chr16:16q24.3 |
likely pathogenic |
NC_000016.10:g.88770428_88832724del |
deletion |
Mucopolysaccharidosis, MPS-IV-A [RCV001578468] |
Chr16:88770428..88832724 [GRCh38] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3969-14C>T |
single nucleotide variant |
not provided [RCV002227326] |
Chr16:88725698 [GRCh38] Chr16:88792106 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.120_125dup (p.Leu41_Pro42dup) |
duplication |
not provided [RCV002227338] |
Chr16:88749418..88749419 [GRCh38] Chr16:88815826..88815827 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2158C>T (p.Arg720Cys) |
single nucleotide variant |
not provided [RCV002227339] |
Chr16:88734378 [GRCh38] Chr16:88800786 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NC_000016.9:g.(?_87636753)_(90109753_?)dup |
duplication |
Granulomatous disease, chronic, autosomal recessive, cytochrome b-negative [RCV003119313]|Primary ciliary dyskinesia 33 [RCV003109228] |
Chr16:87636753..90109753 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4991del (p.Leu1664fs) |
deletion |
not provided [RCV001782618] |
Chr16:88722031 [GRCh38] Chr16:88788439 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.3943C>T (p.Gln1315Ter) |
single nucleotide variant |
not provided [RCV001782619] |
Chr16:88726309 [GRCh38] Chr16:88792717 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.7234C>G (p.Arg2412Gly) |
single nucleotide variant |
not provided [RCV001758328] |
Chr16:88716015 [GRCh38] Chr16:88782423 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1994A>G (p.Glu665Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003956351]|not provided [RCV001767159] |
Chr16:88734653 [GRCh38] Chr16:88801061 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5641C>A (p.Pro1881Thr) |
single nucleotide variant |
PIEZO1-related condition [RCV003956352]|not provided [RCV001767160] |
Chr16:88721193 [GRCh38] Chr16:88787601 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1845C>G (p.Phe615Leu) |
single nucleotide variant |
not provided [RCV001767206] |
Chr16:88734878 [GRCh38] Chr16:88801286 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3213G>C (p.Trp1071Cys) |
single nucleotide variant |
not provided [RCV001754093] |
Chr16:88727645 [GRCh38] Chr16:88794053 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2561C>T (p.Ala854Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004040297]|not provided [RCV001764142] |
Chr16:88733381 [GRCh38] Chr16:88799789 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.946C>T (p.Pro316Ser) |
single nucleotide variant |
not provided [RCV001754618] |
Chr16:88738008 [GRCh38] Chr16:88804416 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7195G>A (p.Gly2399Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002544313]|not provided [RCV001787636] |
Chr16:88716054 [GRCh38] Chr16:88782462 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6616C>T (p.Gln2206Ter) |
single nucleotide variant |
not provided [RCV001784830] |
Chr16:88717067 [GRCh38] Chr16:88783475 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3376C>T (p.Arg1126Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002544098]|not provided [RCV001752494] |
Chr16:88727118 [GRCh38] Chr16:88793526 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5341G>A (p.Gly1781Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002539138]|not provided [RCV001767870] |
Chr16:88721600 [GRCh38] Chr16:88788008 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.6473A>G (p.Lys2158Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV004040132]|not provided [RCV001767207] |
Chr16:88717210 [GRCh38] Chr16:88783618 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 16q23.2-24.3(chr16:80386595-90163348)x3 |
copy number gain |
not provided [RCV001795551] |
Chr16:80386595..90163348 [GRCh37] Chr16:16q23.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.5060C>T (p.Ser1687Leu) |
single nucleotide variant |
not provided [RCV001753967] |
Chr16:88721962 [GRCh38] Chr16:88788370 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6733C>T (p.Arg2245Trp) |
single nucleotide variant |
not provided [RCV001751897] |
Chr16:88716826 [GRCh38] Chr16:88783234 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2908G>C (p.Gly970Arg) |
single nucleotide variant |
not provided [RCV001768927] |
Chr16:88732418 [GRCh38] Chr16:88798826 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4539C>G (p.Phe1513Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002541331]|PIEZO1-related condition [RCV003892853]|not provided [RCV001800011] |
Chr16:88722966 [GRCh38] Chr16:88789374 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3106C>T (p.Arg1036Cys) |
single nucleotide variant |
not provided [RCV001765513] |
Chr16:88731796 [GRCh38] Chr16:88798204 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1001C>T (p.Ala334Val) |
single nucleotide variant |
not provided [RCV001765514] |
Chr16:88737953 [GRCh38] Chr16:88804361 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3619G>C (p.Asp1207His) |
single nucleotide variant |
not provided [RCV001754092] |
Chr16:88726795 [GRCh38] Chr16:88793203 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3331C>T (p.Gln1111Ter) |
single nucleotide variant |
PIEZO1-related condition [RCV003416451]|not provided [RCV001782616] |
Chr16:88727163 [GRCh38] Chr16:88793571 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.4(PIEZO1):c.2257G>T (p.Glu753Ter) |
single nucleotide variant |
not provided [RCV001782617] |
Chr16:88733978 [GRCh38] Chr16:88800386 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.3969-12G>A |
single nucleotide variant |
not provided [RCV001810774] |
Chr16:88725696 [GRCh38] Chr16:88792104 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5340C>T (p.Asp1780=) |
single nucleotide variant |
not provided [RCV001810804] |
Chr16:88721601 [GRCh38] Chr16:88788009 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5134G>C (p.Val1712Leu) |
single nucleotide variant |
not provided [RCV001811957] |
Chr16:88721888 [GRCh38] Chr16:88788296 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1232C>T (p.Pro411Leu) |
single nucleotide variant |
not provided [RCV001812524] |
Chr16:88736703 [GRCh38] Chr16:88803111 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1296+13G>T |
single nucleotide variant |
not provided [RCV001812541] |
Chr16:88736626 [GRCh38] Chr16:88803034 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5632_5633delinsG (p.Lys1878fs) |
indel |
not provided [RCV001812551] |
Chr16:88721201..88721202 [GRCh38] Chr16:88787609..88787610 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4496-13C>T |
single nucleotide variant |
not provided [RCV001812586] |
Chr16:88723022 [GRCh38] Chr16:88789430 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6692C>T (p.Ser2231Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV004040250]|not provided [RCV001763769] |
Chr16:88716867 [GRCh38] Chr16:88783275 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7472_7477dup (p.Arg2491_Glu2492dup) |
duplication |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002503281]|not provided [RCV001795651] |
Chr16:88715693..88715694 [GRCh38] Chr16:88782101..88782102 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2992-23A>G |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001788892]|Lymphatic malformation 6 [RCV001788893]|PIEZO1-related condition [RCV003968553]|not specified [RCV002246505] |
Chr16:88731933 [GRCh38] Chr16:88798341 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.150C>T (p.Cys50=) |
single nucleotide variant |
not provided [RCV001812612] |
Chr16:88749394 [GRCh38] Chr16:88815802 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4744G>A (p.Glu1582Lys) |
single nucleotide variant |
PIEZO1-related condition [RCV003911023]|not provided [RCV001816180] |
Chr16:88722614 [GRCh38] Chr16:88789022 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3303C>T (p.Ser1101=) |
single nucleotide variant |
not provided [RCV001779746] |
Chr16:88727191 [GRCh38] Chr16:88793599 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6800C>T (p.Thr2267Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003163939]|not provided [RCV001810795] |
Chr16:88716685 [GRCh38] Chr16:88783093 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5243A>C (p.Gln1748Pro) |
single nucleotide variant |
not provided [RCV001810812] |
Chr16:88721698 [GRCh38] Chr16:88788106 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.-18G>A |
single nucleotide variant |
not provided [RCV001810766] |
Chr16:88784982 [GRCh38] Chr16:88851390 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2247GGA[6] (p.Glu755_Glu756del) |
microsatellite |
PIEZO1-related condition [RCV003948736]|not provided [RCV001811746] |
Chr16:88733965..88733970 [GRCh38] Chr16:88800373..88800378 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.375C>T (p.Asp125=) |
single nucleotide variant |
not provided [RCV001811832] |
Chr16:88741568 [GRCh38] Chr16:88807976 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4958G>A (p.Arg1653His) |
single nucleotide variant |
not provided [RCV001812516] |
Chr16:88722064 [GRCh38] Chr16:88788472 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6782G>C (p.Ser2261Thr) |
single nucleotide variant |
not provided [RCV001812526] |
Chr16:88716703 [GRCh38] Chr16:88783111 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5934C>T (p.Gly1978=) |
single nucleotide variant |
not provided [RCV001812527] |
Chr16:88720400 [GRCh38] Chr16:88786808 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3672C>T (p.Thr1224=) |
single nucleotide variant |
not provided [RCV001812554] |
Chr16:88726742 [GRCh38] Chr16:88793150 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7129+3G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003913384]|not provided [RCV001812559] |
Chr16:88716195 [GRCh38] Chr16:88782603 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4891C>T (p.Arg1631Cys) |
single nucleotide variant |
not provided [RCV001812584] |
Chr16:88722282 [GRCh38] Chr16:88788690 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4884C>T (p.Pro1628=) |
single nucleotide variant |
not provided [RCV001810780] |
Chr16:88722289 [GRCh38] Chr16:88788697 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5214+15C>T |
single nucleotide variant |
not provided [RCV001811860] |
Chr16:88721793 [GRCh38] Chr16:88788201 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6754-15G>A |
single nucleotide variant |
not provided [RCV001811953] |
Chr16:88716746 [GRCh38] Chr16:88783154 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5507C>A (p.Ala1836Asp) |
single nucleotide variant |
not provided [RCV001810768] |
Chr16:88721327 [GRCh38] Chr16:88787735 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.988C>T (p.Arg330Cys) |
single nucleotide variant |
not provided [RCV001810783] |
Chr16:88737966 [GRCh38] Chr16:88804374 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.3154C>G (p.Gln1052Glu) |
single nucleotide variant |
Inborn genetic diseases [RCV004040887]|not provided [RCV001811701] |
Chr16:88731748 [GRCh38] Chr16:88798156 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4111C>T (p.Arg1371Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV003247028]|not provided [RCV001811702] |
Chr16:88725467 [GRCh38] Chr16:88791875 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.1646C>T (p.Thr549Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002541353]|not provided [RCV001811726] |
Chr16:88735158 [GRCh38] Chr16:88801566 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7204G>C (p.Glu2402Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV003163940]|not provided [RCV001811760] |
Chr16:88716045 [GRCh38] Chr16:88782453 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2992-13_2992-12insCCCCGCCCTCCCCCCAGACTCAGTGCATCCCCACACCCCCCCCTCCCCCCAGACTCAGTGCATCCCCACACCCCGCCCATCCCCAGACTCAGTGCATCCCCACG |
insertion |
not provided [RCV001811764] |
Chr16:88731922..88731923 [GRCh38] Chr16:88798330..88798331 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.64+17C>T |
single nucleotide variant |
not provided [RCV001811774] |
Chr16:88784884 [GRCh38] Chr16:88851292 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6829C>A (p.Leu2277Met) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003151865]|PIEZO1-related condition [RCV003976192]|not provided [RCV001811730] |
Chr16:88716656 [GRCh38] Chr16:88783064 [GRCh37] Chr16:16q24.3 |
likely pathogenic|benign|likely benign|low penetrance |
NM_001142864.4(PIEZO1):c.7558A>G (p.Lys2520Glu) |
single nucleotide variant |
not provided [RCV001811733] |
Chr16:88715613 [GRCh38] Chr16:88782021 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4439-15G>T |
single nucleotide variant |
not provided [RCV001811737] |
Chr16:88723166 [GRCh38] Chr16:88789574 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4775+9G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003931339]|not provided [RCV001811754] |
Chr16:88722574 [GRCh38] Chr16:88788982 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6553G>A (p.Ala2185Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004040891]|not provided [RCV001811771] |
Chr16:88717130 [GRCh38] Chr16:88783538 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6164+12C>T |
single nucleotide variant |
not provided [RCV001811788] |
Chr16:88720057 [GRCh38] Chr16:88786465 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5404-1G>C |
single nucleotide variant |
not provided [RCV001811814] |
Chr16:88721431 [GRCh38] Chr16:88787839 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.5433C>G (p.Asp1811Glu) |
single nucleotide variant |
not provided [RCV001811879] |
Chr16:88721401 [GRCh38] Chr16:88787809 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3922C>G (p.Leu1308Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004040906]|not provided [RCV003132536]|not specified [RCV001806846] |
Chr16:88726330 [GRCh38] Chr16:88792738 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.219C>G (p.Ala73=) |
single nucleotide variant |
not provided [RCV001811716] |
Chr16:88742364 [GRCh38] Chr16:88808772 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.880A>G (p.Thr294Ala) |
single nucleotide variant |
not provided [RCV001811742] |
Chr16:88738074 [GRCh38] Chr16:88804482 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4149C>T (p.Pro1383=) |
single nucleotide variant |
not provided [RCV001811803] |
Chr16:88725429 [GRCh38] Chr16:88791837 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5874C>T (p.Thr1958=) |
single nucleotide variant |
not provided [RCV001811819] |
Chr16:88720460 [GRCh38] Chr16:88786868 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2875G>A (p.Ala959Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004040894]|not provided [RCV001811846] |
Chr16:88732451 [GRCh38] Chr16:88798859 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6892G>A (p.Asp2298Asn) |
single nucleotide variant |
PIEZO1-related condition [RCV003401724]|not provided [RCV001811856] |
Chr16:88716593 [GRCh38] Chr16:88783001 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1558-19del |
deletion |
not provided [RCV001811872] |
Chr16:88735265 [GRCh38] Chr16:88801673 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4284G>A (p.Glu1428=) |
single nucleotide variant |
not provided [RCV001810809] |
Chr16:88723922 [GRCh38] Chr16:88790330 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2059C>T (p.Pro687Ser) |
single nucleotide variant |
not provided [RCV001811708] |
Chr16:88734477 [GRCh38] Chr16:88800885 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3083G>A (p.Arg1028His) |
single nucleotide variant |
not provided [RCV001811787] |
Chr16:88731819 [GRCh38] Chr16:88798227 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1679G>A (p.Arg560Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002542343]|not provided [RCV001811936] |
Chr16:88735044 [GRCh38] Chr16:88801452 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5656G>A (p.Ala1886Thr) |
single nucleotide variant |
not provided [RCV001811707] |
Chr16:88721178 [GRCh38] Chr16:88787586 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7169G>A (p.Arg2390Gln) |
single nucleotide variant |
not provided [RCV001811830] |
Chr16:88716080 [GRCh38] Chr16:88782488 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6750G>A (p.Gln2250=) |
single nucleotide variant |
not provided [RCV001811841] |
Chr16:88716809 [GRCh38] Chr16:88783217 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2590G>A (p.Val864Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003163941]|not provided [RCV001811845] |
Chr16:88733352 [GRCh38] Chr16:88799760 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6471+3G>A |
single nucleotide variant |
not provided [RCV001811928] |
Chr16:88719571 [GRCh38] Chr16:88785979 [GRCh37] Chr16:16q24.3 |
benign |
NC_000016.9:g.(?_88798723)_(88909257_?)dup |
duplication |
Mucopolysaccharidosis, MPS-IV-A [RCV001875013]|not provided [RCV001875014] |
Chr16:88798723..88909257 [GRCh37] Chr16:16q24.3 |
uncertain significance|no classifications from unflagged records |
NM_001142864.4(PIEZO1):c.2167C>T (p.Arg723Cys) |
single nucleotide variant |
not provided [RCV002045551] |
Chr16:88734369 [GRCh38] Chr16:88800777 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88000389-90155062)x3 |
copy number gain |
not provided [RCV001829158] |
Chr16:88000389..90155062 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5668+3A>G |
single nucleotide variant |
not provided [RCV001910831] |
Chr16:88721163 [GRCh38] Chr16:88787571 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.3(chr16:88801603-89509853) |
copy number gain |
not specified [RCV002052562] |
Chr16:88801603..89509853 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.307C>T (p.Arg103Ter) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV001849890] |
Chr16:88742072 [GRCh38] Chr16:88808480 [GRCh37] Chr16:16q24.3 |
pathogenic |
NC_000016.9:g.(?_88709761)_(89623501_?)dup |
duplication |
Hereditary spastic paraplegia 7 [RCV002020725] |
Chr16:88709761..89623501 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5284C>T (p.Arg1762Cys) |
single nucleotide variant |
not provided [RCV002024537]|not specified [RCV003493907] |
Chr16:88721657 [GRCh38] Chr16:88788065 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4117C>T (p.Arg1373Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004040545]|not provided [RCV001872849] |
Chr16:88725461 [GRCh38] Chr16:88791869 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.848+5C>T |
single nucleotide variant |
not provided [RCV001921615] |
Chr16:88738222 [GRCh38] Chr16:88804630 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1550G>A (p.Gly517Asp) |
single nucleotide variant |
not provided [RCV002001070] |
Chr16:88736155 [GRCh38] Chr16:88802563 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6262C>G (p.Arg2088Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003418353]|not provided [RCV002036423] |
Chr16:88719863 [GRCh38] Chr16:88786271 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.3416G>A (p.Arg1139Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003407870]|not provided [RCV001880786] |
Chr16:88727078 [GRCh38] Chr16:88793486 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4623C>A (p.Asp1541Glu) |
single nucleotide variant |
PIEZO1-related condition [RCV003913477]|not provided [RCV001989258] |
Chr16:88722882 [GRCh38] Chr16:88789290 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NC_000016.9:g.(?_87636753)_(89723996_?)dup |
duplication |
Mucopolysaccharidosis, MPS-IV-A [RCV001939908] |
Chr16:87636753..89723996 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5312C>T (p.Pro1771Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004042714]|not provided [RCV001906948] |
Chr16:88721629 [GRCh38] Chr16:88788037 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6494AGA[6] (p.Lys2169dup) |
microsatellite |
not provided [RCV001991397] |
Chr16:88717174..88717175 [GRCh38] Chr16:88783582..88783583 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5762G>A (p.Arg1921Lys) |
single nucleotide variant |
not provided [RCV001879253] |
Chr16:88720655 [GRCh38] Chr16:88787063 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4388AGCAGG[2] (p.1465EQ[1]) |
microsatellite |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002482435]|not provided [RCV002051388] |
Chr16:88723259..88723264 [GRCh38] Chr16:88789667..88789672 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NC_000016.9:g.(?_88782947)_(88878307_?)del |
deletion |
not provided [RCV001953474] |
Chr16:88782947..88878307 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2759G>A (p.Arg920Gln) |
single nucleotide variant |
not provided [RCV002016962] |
Chr16:88732638 [GRCh38] Chr16:88799046 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4662C>T (p.Leu1554=) |
single nucleotide variant |
PIEZO1-related condition [RCV003913681]|not provided [RCV002105420] |
Chr16:88722843 [GRCh38] Chr16:88789251 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6872A>C (p.Glu2291Ala) |
single nucleotide variant |
not provided [RCV002224873] |
Chr16:88716613 [GRCh38] Chr16:88783021 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6660+13G>T |
single nucleotide variant |
not provided [RCV002208215] |
Chr16:88717010 [GRCh38] Chr16:88783418 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.90C>T (p.Leu30=) |
single nucleotide variant |
not provided [RCV002109243] |
Chr16:88749454 [GRCh38] Chr16:88815862 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4036T>G (p.Ser1346Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV003007087]|not provided [RCV002091164] |
Chr16:88725617 [GRCh38] Chr16:88792025 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7092C>A (p.Asn2364Lys) |
single nucleotide variant |
not provided [RCV002211370] |
Chr16:88716235 [GRCh38] Chr16:88782643 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4981G>A (p.Glu1661Lys) |
single nucleotide variant |
not provided [RCV002211371] |
Chr16:88722041 [GRCh38] Chr16:88788449 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1296+8G>T |
single nucleotide variant |
not provided [RCV002211372] |
Chr16:88736631 [GRCh38] Chr16:88803039 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3700-26_3700-18del |
microsatellite |
not provided [RCV002205718] |
Chr16:88726661..88726669 [GRCh38] Chr16:88793069..88793077 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7129+5G>A |
single nucleotide variant |
not provided [RCV002224572] |
Chr16:88716193 [GRCh38] Chr16:88782601 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4713C>G (p.Ser1571Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV002993438]|not provided [RCV002207391] |
Chr16:88722645 [GRCh38] Chr16:88789053 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.7387T>G (p.Ser2463Ala) |
single nucleotide variant |
not provided [RCV002227322] |
Chr16:88715784 [GRCh38] Chr16:88782192 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7431C>G (p.Ile2477Met) |
single nucleotide variant |
not provided [RCV002227332] |
Chr16:88715740 [GRCh38] Chr16:88782148 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5598G>C (p.Thr1866=) |
single nucleotide variant |
not provided [RCV002227336] |
Chr16:88721236 [GRCh38] Chr16:88787644 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3699+6C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003926333]|not provided [RCV002227388] |
Chr16:88726709 [GRCh38] Chr16:88793117 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5169G>A (p.Pro1723=) |
single nucleotide variant |
not provided [RCV002208536] |
Chr16:88721853 [GRCh38] Chr16:88788261 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2982C>G (p.Phe994Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003015332]|PIEZO1-related condition [RCV003903378]|not provided [RCV002115630] |
Chr16:88732344 [GRCh38] Chr16:88798752 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.812C>T (p.Ala271Val) |
single nucleotide variant |
not provided [RCV002211373] |
Chr16:88738263 [GRCh38] Chr16:88804671 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3699+20del |
deletion |
not provided [RCV002127094] |
Chr16:88726695 [GRCh38] Chr16:88793103 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1207C>T (p.Arg403Trp) |
single nucleotide variant |
not provided [RCV002145015] |
Chr16:88736728 [GRCh38] Chr16:88803136 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2790+18T>A |
single nucleotide variant |
not provided [RCV002131384] |
Chr16:88732589 [GRCh38] Chr16:88798997 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6661-18T>G |
single nucleotide variant |
not provided [RCV002123570] |
Chr16:88716916 [GRCh38] Chr16:88783324 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1296+12T>C |
single nucleotide variant |
not provided [RCV002216438] |
Chr16:88736627 [GRCh38] Chr16:88803035 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3432C>T (p.Pro1144=) |
single nucleotide variant |
not provided [RCV002101833] |
Chr16:88727062 [GRCh38] Chr16:88793470 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2124C>T (p.Leu708=) |
single nucleotide variant |
not provided [RCV002100768] |
Chr16:88734412 [GRCh38] Chr16:88800820 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3699+14C>A |
single nucleotide variant |
not provided [RCV002118648] |
Chr16:88726701 [GRCh38] Chr16:88793109 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4059-9_4059-8del |
deletion |
not provided [RCV002155237] |
Chr16:88725527..88725528 [GRCh38] Chr16:88791935..88791936 [GRCh37] Chr16:16q24.3 |
likely benign |
GRCh37/hg19 16q11.2-24.3(chr16:46503968-90155062)x3 |
copy number gain |
not provided [RCV002221458] |
Chr16:46503968..90155062 [GRCh37] Chr16:16q11.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4955+14G>A |
single nucleotide variant |
not provided [RCV002181409] |
Chr16:88722204 [GRCh38] Chr16:88788612 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7380C>G (p.Ser2460Arg) |
single nucleotide variant |
Hemolytic anemia [RCV002222276]|PIEZO1-related condition [RCV003408170] |
Chr16:88715791 [GRCh38] Chr16:88782199 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2731G>A (p.Val911Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003101295]|not provided [RCV002227324] |
Chr16:88732666 [GRCh38] Chr16:88799074 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4059-10C>A |
single nucleotide variant |
not provided [RCV002180028] |
Chr16:88725529 [GRCh38] Chr16:88791937 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7129+14T>C |
single nucleotide variant |
not provided [RCV002204070] |
Chr16:88716184 [GRCh38] Chr16:88782592 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4163-14C>T |
single nucleotide variant |
not provided [RCV002118629] |
Chr16:88725094 [GRCh38] Chr16:88791502 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1375C>T (p.Arg459Cys) |
single nucleotide variant |
not provided [RCV003112497] |
Chr16:88736330 [GRCh38] Chr16:88802738 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.7462C>T (p.Arg2488Trp) |
single nucleotide variant |
not provided [RCV003115953] |
Chr16:88715709 [GRCh38] Chr16:88782117 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.1848+15G>A |
single nucleotide variant |
not provided [RCV003120104] |
Chr16:88734860 [GRCh38] Chr16:88801268 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4212G>C (p.Arg1404=) |
single nucleotide variant |
not provided [RCV003120106] |
Chr16:88725031 [GRCh38] Chr16:88791439 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2946C>T (p.Cys982=) |
single nucleotide variant |
not provided [RCV003120111] |
Chr16:88732380 [GRCh38] Chr16:88798788 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6886A>C (p.Thr2296Pro) |
single nucleotide variant |
PIEZO1-related condition [RCV003946438]|not provided [RCV003120117] |
Chr16:88716599 [GRCh38] Chr16:88783007 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4041G>A (p.Leu1347=) |
single nucleotide variant |
not provided [RCV003120130] |
Chr16:88725612 [GRCh38] Chr16:88792020 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4556A>C (p.Gln1519Pro) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003333240]|not provided [RCV003120152] |
Chr16:88722949 [GRCh38] Chr16:88789357 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2722C>T (p.Arg908Trp) |
single nucleotide variant |
not provided [RCV003120155] |
Chr16:88732675 [GRCh38] Chr16:88799083 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3048C>A (p.Thr1016=) |
single nucleotide variant |
not provided [RCV003120161] |
Chr16:88731854 [GRCh38] Chr16:88798262 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6353T>A (p.Leu2118Gln) |
single nucleotide variant |
not provided [RCV003120204] |
Chr16:88719692 [GRCh38] Chr16:88786100 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5475G>A (p.Gln1825=) |
single nucleotide variant |
not provided [RCV003120254] |
Chr16:88721359 [GRCh38] Chr16:88787767 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5778G>A (p.Arg1926=) |
single nucleotide variant |
not provided [RCV003120270] |
Chr16:88720639 [GRCh38] Chr16:88787047 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.7007G>A (p.Arg2336Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003410263]|not provided [RCV003120283] |
Chr16:88716403 [GRCh38] Chr16:88782811 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5214+16G>T |
single nucleotide variant |
not provided [RCV003120298] |
Chr16:88721792 [GRCh38] Chr16:88788200 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6328C>T (p.Arg2110Trp) |
single nucleotide variant |
not provided [RCV003120326] |
Chr16:88719717 [GRCh38] Chr16:88786125 [GRCh37] Chr16:16q24.3 |
likely pathogenic|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.3196+12G>A |
single nucleotide variant |
not provided [RCV003120329] |
Chr16:88731694 [GRCh38] Chr16:88798102 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4215C>G (p.Pro1405=) |
single nucleotide variant |
not provided [RCV003120335] |
Chr16:88725028 [GRCh38] Chr16:88791436 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3625C>T (p.Arg1209Trp) |
single nucleotide variant |
PIEZO1-related condition [RCV003395699]|not provided [RCV003120357] |
Chr16:88726789 [GRCh38] Chr16:88793197 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001012759.3(CTU2):c.1509_1512dup (p.Ile505fs) |
duplication |
not provided [RCV003319680] |
Chr16:88715208..88715209 [GRCh38] Chr16:88781616..88781617 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1930G>C (p.Val644Leu) |
single nucleotide variant |
not specified [RCV003320512] |
Chr16:88734717 [GRCh38] Chr16:88801125 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2838C>A (p.Tyr946Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003147850] |
Chr16:88732488 [GRCh38] Chr16:88798896 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2546G>A (p.Arg849His) |
single nucleotide variant |
Inborn genetic diseases [RCV003358142]|not provided [RCV003134889] |
Chr16:88733396 [GRCh38] Chr16:88799804 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7219G>A (p.Glu2407Lys) |
single nucleotide variant |
Blood group, ER [RCV003152450]|not provided [RCV003491338] |
Chr16:88716030 [GRCh38] Chr16:88782438 [GRCh37] Chr16:16q24.3 |
affects|uncertain significance |
PIEZO1, ARG2245GLN (rs2290901) |
single nucleotide variant |
Blood group, ER [RCV003152451] |
|
affects |
NM_001142864.4(PIEZO1):c.4668+12C>T |
single nucleotide variant |
not provided [RCV002227309] |
Chr16:88722825 [GRCh38] Chr16:88789233 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6906C>T (p.Arg2302=) |
single nucleotide variant |
not provided [RCV002227323] |
Chr16:88716579 [GRCh38] Chr16:88782987 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5464G>C (p.Glu1822Gln) |
single nucleotide variant |
not provided [RCV002227331] |
Chr16:88721370 [GRCh38] Chr16:88787778 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4058+1G>C |
single nucleotide variant |
Lymphatic malformation 6 [RCV003153144] |
Chr16:88725594 [GRCh38] Chr16:88792002 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3699+20_3699+21delinsCG |
indel |
not provided [RCV002227310] |
Chr16:88726694..88726695 [GRCh38] Chr16:88793102..88793103 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6333G>A (p.Leu2111=) |
single nucleotide variant |
not provided [RCV002227341] |
Chr16:88719712 [GRCh38] Chr16:88786120 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5272G>C (p.Val1758Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002243588] |
Chr16:88721669 [GRCh38] Chr16:88788077 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4341del (p.Tyr1448fs) |
deletion |
Lymphatic malformation 6 [RCV003233377] |
Chr16:88723323 [GRCh38] Chr16:88789731 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.4579C>T (p.Arg1527Cys) |
single nucleotide variant |
not provided [RCV003131918] |
Chr16:88722926 [GRCh38] Chr16:88789334 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7507C>T (p.Leu2503Phe) |
single nucleotide variant |
not provided [RCV003131919] |
Chr16:88715664 [GRCh38] Chr16:88782072 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2252A>C (p.Glu751Ala) |
single nucleotide variant |
not provided [RCV003131923] |
Chr16:88733983 [GRCh38] Chr16:88800391 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3542G>A (p.Arg1181His) |
single nucleotide variant |
not provided [RCV003131924] |
Chr16:88726872 [GRCh38] Chr16:88793280 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4559C>G (p.Ala1520Gly) |
single nucleotide variant |
not provided [RCV003131936] |
Chr16:88722946 [GRCh38] Chr16:88789354 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5527C>G (p.Gln1843Glu) |
single nucleotide variant |
not provided [RCV003131938] |
Chr16:88721307 [GRCh38] Chr16:88787715 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NC_000016.9:g.88365786_89584412del1218627 |
deletion |
KBG syndrome [RCV002275248] |
Chr16:88365786..89584412 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6574C>A (p.Leu2192Ile) |
single nucleotide variant |
not provided [RCV002261542] |
Chr16:88717109 [GRCh38] Chr16:88783517 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4904C>G (p.Ala1635Gly) |
single nucleotide variant |
not provided [RCV002261546] |
Chr16:88722269 [GRCh38] Chr16:88788677 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7351A>G (p.Ile2451Val) |
single nucleotide variant |
not provided [RCV002261538] |
Chr16:88715820 [GRCh38] Chr16:88782228 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6165-5C>T |
single nucleotide variant |
not provided [RCV002261543] |
Chr16:88719965 [GRCh38] Chr16:88786373 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4669-5T>G |
single nucleotide variant |
not provided [RCV002261547] |
Chr16:88722694 [GRCh38] Chr16:88789102 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1196-4G>C |
single nucleotide variant |
not provided [RCV002261553] |
Chr16:88736743 [GRCh38] Chr16:88803151 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2909G>A (p.Gly970Asp) |
single nucleotide variant |
not provided [RCV002261550] |
Chr16:88732417 [GRCh38] Chr16:88798825 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1333G>A (p.Val445Ile) |
single nucleotide variant |
PIEZO1-related condition [RCV003896094]|not provided [RCV002261552] |
Chr16:88736372 [GRCh38] Chr16:88802780 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6771C>T (p.Ile2257=) |
single nucleotide variant |
not provided [RCV002261541] |
Chr16:88716714 [GRCh38] Chr16:88783122 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5105C>T (p.Thr1702Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003101450]|not provided [RCV002261545] |
Chr16:88721917 [GRCh38] Chr16:88788325 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.65-17C>T |
single nucleotide variant |
not provided [RCV002261554] |
Chr16:88749496 [GRCh38] Chr16:88815904 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1297-1G>A |
single nucleotide variant |
Lymphatic malformation 6 [RCV002272653] |
Chr16:88736409 [GRCh38] Chr16:88802817 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.7102G>A (p.Ala2368Thr) |
single nucleotide variant |
not provided [RCV002267263] |
Chr16:88716225 [GRCh38] Chr16:88782633 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6992A>G (p.Asn2331Ser) |
single nucleotide variant |
not provided [RCV002261540] |
Chr16:88716418 [GRCh38] Chr16:88782826 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5290G>A (p.Glu1764Lys) |
single nucleotide variant |
not provided [RCV002261544] |
Chr16:88721651 [GRCh38] Chr16:88788059 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4914C>G (p.Tyr1638Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003236246] |
Chr16:88722259 [GRCh38] Chr16:88788667 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.113TGC[3] (p.Leu41del) |
microsatellite |
Lymphatic malformation 6 [RCV003236247] |
Chr16:88749420..88749422 [GRCh38] Chr16:88815828..88815830 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.7316+4AGTG[3] |
microsatellite |
not provided [RCV002261539] |
Chr16:88715921..88715922 [GRCh38] Chr16:88782329..88782330 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4444G>T (p.Gly1482Cys) |
single nucleotide variant |
not provided [RCV002261548] |
Chr16:88723146 [GRCh38] Chr16:88789554 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1442G>A (p.Arg481His) |
single nucleotide variant |
not provided [RCV002261551] |
Chr16:88736263 [GRCh38] Chr16:88802671 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2664G>A (p.Glu888=) |
single nucleotide variant |
Lymphatic malformation 6 [RCV002289404] |
Chr16:88733278 [GRCh38] Chr16:88799686 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6901_6912del (p.Leu2301_Thr2304del) |
deletion |
Lymphatic malformation 6 [RCV002289405] |
Chr16:88716573..88716584 [GRCh38] Chr16:88782981..88782992 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1381C>T (p.Gln461Ter) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV002286446]|not provided [RCV002293594] |
Chr16:88736324 [GRCh38] Chr16:88802732 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.1499G>C (p.Ser500Thr) |
single nucleotide variant |
not provided [RCV002265253] |
Chr16:88736206 [GRCh38] Chr16:88802614 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7540A>C (p.Ile2514Leu) |
single nucleotide variant |
not provided [RCV002261536] |
Chr16:88715631 [GRCh38] Chr16:88782039 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7354G>A (p.Gly2452Ser) |
single nucleotide variant |
not provided [RCV002261537] |
Chr16:88715817 [GRCh38] Chr16:88782225 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4235-23C>G |
single nucleotide variant |
not provided [RCV002261549] |
Chr16:88723994 [GRCh38] Chr16:88790402 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q22.2-24.3(chr16:71641395-90161959)x3 |
copy number gain |
Syndromic anorectal malformation [RCV002286607] |
Chr16:71641395..90161959 [GRCh37] Chr16:16q22.2-24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2776C>G (p.Leu926Val) |
single nucleotide variant |
not provided [RCV002273669] |
Chr16:88732621 [GRCh38] Chr16:88799029 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5224GTC[1] (p.Val1743del) |
microsatellite |
not provided [RCV003233376] |
Chr16:88721712..88721714 [GRCh38] Chr16:88788120..88788122 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2545C>T (p.Arg849Cys) |
single nucleotide variant |
not provided [RCV003154341] |
Chr16:88733397 [GRCh38] Chr16:88799805 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6059C>T (p.Ala2020Val) |
single nucleotide variant |
not provided [RCV002307467] |
Chr16:88720174 [GRCh38] Chr16:88786582 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2896G>A (p.Val966Met) |
single nucleotide variant |
not provided [RCV002306338] |
Chr16:88732430 [GRCh38] Chr16:88798838 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6407G>T (p.Trp2136Leu) |
single nucleotide variant |
not provided [RCV002298200] |
Chr16:88719638 [GRCh38] Chr16:88786046 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3137C>T (p.Ala1046Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002859852]|not provided [RCV003883905] |
Chr16:88731765 [GRCh38] Chr16:88798173 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4881C>A (p.Asp1627Glu) |
single nucleotide variant |
Inborn genetic diseases [RCV002749500] |
Chr16:88722292 [GRCh38] Chr16:88788700 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7427G>A (p.Arg2476His) |
single nucleotide variant |
Inborn genetic diseases [RCV002771967] |
Chr16:88715744 [GRCh38] Chr16:88782152 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5960C>T (p.Ala1987Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002729848]|not provided [RCV003561167] |
Chr16:88720273 [GRCh38] Chr16:88786681 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.2387C>T (p.Ser796Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002771742] |
Chr16:88733688 [GRCh38] Chr16:88800096 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5597C>T (p.Thr1866Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002774105] |
Chr16:88721237 [GRCh38] Chr16:88787645 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4370C>T (p.Ala1457Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002773779]|PIEZO1-related condition [RCV003410253] |
Chr16:88723294 [GRCh38] Chr16:88789702 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3699+20_3699+21delinsCA |
indel |
not provided [RCV002775827] |
Chr16:88726694..88726695 [GRCh38] Chr16:88793102..88793103 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2781C>T (p.Gly927=) |
single nucleotide variant |
not provided [RCV002615222] |
Chr16:88732616 [GRCh38] Chr16:88799024 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1839C>T (p.Thr613=) |
single nucleotide variant |
not provided [RCV002613927] |
Chr16:88734884 [GRCh38] Chr16:88801292 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.427G>A (p.Ala143Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002616154]|not provided [RCV002616153] |
Chr16:88741516 [GRCh38] Chr16:88807924 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3326C>T (p.Ala1109Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002990191]|not provided [RCV003491297] |
Chr16:88727168 [GRCh38] Chr16:88793576 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7235G>A (p.Arg2412Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002864171] |
Chr16:88716014 [GRCh38] Chr16:88782422 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6539T>G (p.Ile2180Ser) |
single nucleotide variant |
not provided [RCV002843146] |
Chr16:88717144 [GRCh38] Chr16:88783552 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2765G>C (p.Gly922Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV002997212]|not provided [RCV003481431] |
Chr16:88732632 [GRCh38] Chr16:88799040 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7469C>T (p.Thr2490Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV002686903] |
Chr16:88715702 [GRCh38] Chr16:88782110 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3603G>A (p.Thr1201=) |
single nucleotide variant |
not provided [RCV003075857] |
Chr16:88726811 [GRCh38] Chr16:88793219 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2233CAG[6] (p.Gln749_Glu750insGln) |
microsatellite |
PIEZO1-related condition [RCV003943760]|not provided [RCV003075529] |
Chr16:88733987..88733988 [GRCh38] Chr16:88800395..88800396 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.2326G>C (p.Glu776Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002732950] |
Chr16:88733909 [GRCh38] Chr16:88800317 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7440C>G (p.Leu2480=) |
single nucleotide variant |
not provided [RCV002636182] |
Chr16:88715731 [GRCh38] Chr16:88782139 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6581T>A (p.Met2194Lys) |
single nucleotide variant |
not provided [RCV002819672] |
Chr16:88717102 [GRCh38] Chr16:88783510 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.900C>T (p.His300=) |
single nucleotide variant |
not provided [RCV002971666] |
Chr16:88738054 [GRCh38] Chr16:88804462 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5545G>A (p.Gly1849Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV002778519] |
Chr16:88721289 [GRCh38] Chr16:88787697 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2248G>C (p.Glu750Gln) |
single nucleotide variant |
not provided [RCV002908711] |
Chr16:88733987 [GRCh38] Chr16:88800395 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7561G>C (p.Glu2521Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002903344]|not provided [RCV002895423] |
Chr16:88715610 [GRCh38] Chr16:88782018 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5106G>A (p.Thr1702=) |
single nucleotide variant |
not provided [RCV003075135] |
Chr16:88721916 [GRCh38] Chr16:88788324 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3809T>C (p.Met1270Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002839877] |
Chr16:88726443 [GRCh38] Chr16:88792851 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6660G>C (p.Glu2220Asp) |
single nucleotide variant |
not provided [RCV002995700] |
Chr16:88717023 [GRCh38] Chr16:88783431 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4768G>A (p.Val1590Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002839920] |
Chr16:88722590 [GRCh38] Chr16:88788998 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.955C>G (p.Leu319Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002818846] |
Chr16:88737999 [GRCh38] Chr16:88804407 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3744C>T (p.Cys1248=) |
single nucleotide variant |
not provided [RCV002730915] |
Chr16:88726599 [GRCh38] Chr16:88793007 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4690G>A (p.Val1564Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002752690] |
Chr16:88722668 [GRCh38] Chr16:88789076 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2213G>A (p.Arg738Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002754236] |
Chr16:88734022 [GRCh38] Chr16:88800430 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2440G>A (p.Val814Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV002687270]|PIEZO1-related condition [RCV003410153] |
Chr16:88733635 [GRCh38] Chr16:88800043 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5704G>A (p.Glu1902Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002879760] |
Chr16:88720713 [GRCh38] Chr16:88787121 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2696C>T (p.Thr899Met) |
single nucleotide variant |
not provided [RCV002616084] |
Chr16:88732701 [GRCh38] Chr16:88799109 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1729G>A (p.Ala577Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002992635] |
Chr16:88734994 [GRCh38] Chr16:88801402 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3626G>A (p.Arg1209Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002683853]|not provided [RCV003135269] |
Chr16:88726788 [GRCh38] Chr16:88793196 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.3632G>A (p.Arg1211His) |
single nucleotide variant |
Inborn genetic diseases [RCV002683918]|PIEZO1-related condition [RCV003946403]|not provided [RCV003135270] |
Chr16:88726782 [GRCh38] Chr16:88793190 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3923T>C (p.Leu1308Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002734507] |
Chr16:88726329 [GRCh38] Chr16:88792737 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.458G>A (p.Arg153Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002779836] |
Chr16:88741485 [GRCh38] Chr16:88807893 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7365G>A (p.Val2455=) |
single nucleotide variant |
PIEZO1-related condition [RCV003916746]|not provided [RCV003075786] |
Chr16:88715806 [GRCh38] Chr16:88782214 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6231C>G (p.Ser2077=) |
single nucleotide variant |
not provided [RCV002996392] |
Chr16:88719894 [GRCh38] Chr16:88786302 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3274C>T (p.Arg1092Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002688068]|not provided [RCV003140156] |
Chr16:88727584 [GRCh38] Chr16:88793992 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1183C>A (p.Leu395Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002732912] |
Chr16:88737571 [GRCh38] Chr16:88803979 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1129G>A (p.Asp377Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002849461] |
Chr16:88737625 [GRCh38] Chr16:88804033 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6104T>G (p.Val2035Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002823143] |
Chr16:88720129 [GRCh38] Chr16:88786537 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2839C>T (p.Arg947Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002708378] |
Chr16:88732487 [GRCh38] Chr16:88798895 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6460G>A (p.Glu2154Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002981408] |
Chr16:88719585 [GRCh38] Chr16:88785993 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.730G>A (p.Gly244Ser) |
single nucleotide variant |
not provided [RCV002948818] |
Chr16:88738345 [GRCh38] Chr16:88804753 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3700-13_3700-5dup |
duplication |
not provided [RCV002889325] |
Chr16:88726647..88726648 [GRCh38] Chr16:88793055..88793056 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6652G>A (p.Gly2218Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002786094]|not provided [RCV002786093] |
Chr16:88717031 [GRCh38] Chr16:88783439 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.160+20C>G |
single nucleotide variant |
not provided [RCV002795764] |
Chr16:88749364 [GRCh38] Chr16:88815772 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1657G>A (p.Val553Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002739267]|PIEZO1-related condition [RCV003963788] |
Chr16:88735147 [GRCh38] Chr16:88801555 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3810G>A (p.Met1270Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV002785092] |
Chr16:88726442 [GRCh38] Chr16:88792850 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5770G>A (p.Gly1924Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV002981029] |
Chr16:88720647 [GRCh38] Chr16:88787055 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.166A>C (p.Thr56Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002978059] |
Chr16:88742417 [GRCh38] Chr16:88808825 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7061A>G (p.Asn2354Ser) |
single nucleotide variant |
not provided [RCV002927969] |
Chr16:88716266 [GRCh38] Chr16:88782674 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1998-12G>T |
single nucleotide variant |
not provided [RCV002843965] |
Chr16:88734550 [GRCh38] Chr16:88800958 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2476G>A (p.Ala826Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002910782] |
Chr16:88733599 [GRCh38] Chr16:88800007 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4668+13G>A |
single nucleotide variant |
not provided [RCV002795304] |
Chr16:88722824 [GRCh38] Chr16:88789232 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4743C>T (p.Thr1581=) |
single nucleotide variant |
PIEZO1-related condition [RCV003936548]|not provided [RCV003080168] |
Chr16:88722615 [GRCh38] Chr16:88789023 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4998G>C (p.Ala1666=) |
single nucleotide variant |
not provided [RCV002885512] |
Chr16:88722024 [GRCh38] Chr16:88788432 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2827G>A (p.Ala943Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002976732] |
Chr16:88732499 [GRCh38] Chr16:88798907 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1162C>G (p.Leu388Val) |
single nucleotide variant |
not provided [RCV002691089] |
Chr16:88737592 [GRCh38] Chr16:88804000 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3783G>C (p.Lys1261Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002952341]|PIEZO1-related condition [RCV003427644]|not provided [RCV003738335] |
Chr16:88726560 [GRCh38] Chr16:88792968 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4666C>T (p.Gln1556Ter) |
single nucleotide variant |
not provided [RCV002824058] |
Chr16:88722839 [GRCh38] Chr16:88789247 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.5564C>T (p.Pro1855Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002602728]|not provided [RCV002619172] |
Chr16:88721270 [GRCh38] Chr16:88787678 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.4245C>T (p.Ser1415=) |
single nucleotide variant |
not provided [RCV002619173] |
Chr16:88723961 [GRCh38] Chr16:88790369 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2872C>G (p.Leu958Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002759216] |
Chr16:88732454 [GRCh38] Chr16:88798862 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2128G>A (p.Asp710Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002704851] |
Chr16:88734408 [GRCh38] Chr16:88800816 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2840G>A (p.Arg947Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002660003] |
Chr16:88732486 [GRCh38] Chr16:88798894 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4609G>C (p.Gly1537Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV002912071]|not provided [RCV003135255] |
Chr16:88722896 [GRCh38] Chr16:88789304 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.3016G>A (p.Val1006Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002797921]|not provided [RCV003738313] |
Chr16:88731886 [GRCh38] Chr16:88798294 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.145C>T (p.Arg49Ter) |
single nucleotide variant |
not provided [RCV002637435] |
Chr16:88749399 [GRCh38] Chr16:88815807 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.457C>T (p.Arg153Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002799024] |
Chr16:88741486 [GRCh38] Chr16:88807894 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2012G>A (p.Gly671Asp) |
single nucleotide variant |
Inborn genetic diseases [RCV002844171] |
Chr16:88734524 [GRCh38] Chr16:88800932 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1206G>C (p.Lys402Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002911339] |
Chr16:88736729 [GRCh38] Chr16:88803137 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3631C>T (p.Arg1211Cys) |
single nucleotide variant |
not provided [RCV002886509] |
Chr16:88726783 [GRCh38] Chr16:88793191 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4496-4G>A |
single nucleotide variant |
not provided [RCV002736857] |
Chr16:88723013 [GRCh38] Chr16:88789421 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2545C>G (p.Arg849Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002887133] |
Chr16:88733397 [GRCh38] Chr16:88799805 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6739T>C (p.Phe2247Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002821682] |
Chr16:88716820 [GRCh38] Chr16:88783228 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2354C>T (p.Ala785Val) |
single nucleotide variant |
not provided [RCV002706328] |
Chr16:88733721 [GRCh38] Chr16:88800129 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6356G>A (p.Arg2119Gln) |
single nucleotide variant |
not provided [RCV002952960] |
Chr16:88719689 [GRCh38] Chr16:88786097 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5806C>A (p.Gln1936Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002978124] |
Chr16:88720528 [GRCh38] Chr16:88786936 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1373G>C (p.Ser458Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002739524] |
Chr16:88736332 [GRCh38] Chr16:88802740 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3400C>A (p.Arg1134Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002692435] |
Chr16:88727094 [GRCh38] Chr16:88793502 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1178C>T (p.Ser393Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV002693268]|not provided [RCV003151925] |
Chr16:88737576 [GRCh38] Chr16:88803984 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7363G>T (p.Val2455Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002737464] |
Chr16:88715808 [GRCh38] Chr16:88782216 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7067T>A (p.Phe2356Tyr) |
single nucleotide variant |
Inborn genetic diseases [RCV002844148] |
Chr16:88716260 [GRCh38] Chr16:88782668 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4181G>C (p.Gly1394Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV002844172] |
Chr16:88725062 [GRCh38] Chr16:88791470 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1671G>A (p.Glu557=) |
single nucleotide variant |
not provided [RCV002619174] |
Chr16:88735052 [GRCh38] Chr16:88801460 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1297-7C>G |
single nucleotide variant |
not provided [RCV002619175] |
Chr16:88736415 [GRCh38] Chr16:88802823 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1466G>A (p.Arg489His) |
single nucleotide variant |
not provided [RCV003078865] |
Chr16:88736239 [GRCh38] Chr16:88802647 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4364C>T (p.Ala1455Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002978190]|not provided [RCV003130882] |
Chr16:88723300 [GRCh38] Chr16:88789708 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5162C>T (p.Ser1721Leu) |
single nucleotide variant |
not provided [RCV002509939] |
Chr16:88721860 [GRCh38] Chr16:88788268 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6689C>T (p.Pro2230Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002783848] |
Chr16:88716870 [GRCh38] Chr16:88783278 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4776T>C (p.Ser1592=) |
single nucleotide variant |
Inborn genetic diseases [RCV003348931]|not provided [RCV002913593] |
Chr16:88722397 [GRCh38] Chr16:88788805 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5200A>G (p.Ile1734Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002868634] |
Chr16:88721822 [GRCh38] Chr16:88788230 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4180G>A (p.Gly1394Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002978022]|PIEZO1-related condition [RCV003420489]|not provided [RCV003738336] |
Chr16:88725063 [GRCh38] Chr16:88791471 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2895C>T (p.Ala965=) |
single nucleotide variant |
PIEZO1-related condition [RCV003892207]|not provided [RCV002976565] |
Chr16:88732431 [GRCh38] Chr16:88798839 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4776-15G>A |
single nucleotide variant |
not provided [RCV002593635] |
Chr16:88722412 [GRCh38] Chr16:88788820 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5636A>G (p.Glu1879Gly) |
single nucleotide variant |
not provided [RCV003083994] |
Chr16:88721198 [GRCh38] Chr16:88787606 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2390A>G (p.Asp797Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002713592] |
Chr16:88733685 [GRCh38] Chr16:88800093 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2132T>A (p.Met711Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002933896]|PIEZO1-related condition [RCV003409971]|not provided [RCV002957254] |
Chr16:88734404 [GRCh38] Chr16:88800812 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.1132A>G (p.Thr378Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV002699503]|not provided [RCV003491308] |
Chr16:88737622 [GRCh38] Chr16:88804030 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6250G>A (p.Gly2084Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002892963]|PIEZO1-related condition [RCV003410186]|not provided [RCV003111708] |
Chr16:88719875 [GRCh38] Chr16:88786283 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1186C>T (p.Arg396Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002853550]|not provided [RCV003329468] |
Chr16:88737568 [GRCh38] Chr16:88803976 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2791-5C>T |
single nucleotide variant |
not provided [RCV003085333] |
Chr16:88732540 [GRCh38] Chr16:88798948 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4067G>A (p.Arg1356His) |
single nucleotide variant |
Inborn genetic diseases [RCV002986819] |
Chr16:88725511 [GRCh38] Chr16:88791919 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4609G>A (p.Gly1537Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002955078] |
Chr16:88722896 [GRCh38] Chr16:88789304 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1376G>A (p.Arg459His) |
single nucleotide variant |
Inborn genetic diseases [RCV002893334] |
Chr16:88736329 [GRCh38] Chr16:88802737 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5780T>A (p.Leu1927Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002987397] |
Chr16:88720637 [GRCh38] Chr16:88787045 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5134G>A (p.Val1712Met) |
single nucleotide variant |
not provided [RCV003058511] |
Chr16:88721888 [GRCh38] Chr16:88788296 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3302-12T>G |
single nucleotide variant |
not provided [RCV002741166] |
Chr16:88727204 [GRCh38] Chr16:88793612 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.439C>T (p.Arg147Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002641765] |
Chr16:88741504 [GRCh38] Chr16:88807912 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4304A>C (p.Asp1435Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV002929868] |
Chr16:88723902 [GRCh38] Chr16:88790310 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7231T>A (p.Cys2411Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002873135] |
Chr16:88716018 [GRCh38] Chr16:88782426 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.579C>A (p.His193Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002802825] |
Chr16:88738623 [GRCh38] Chr16:88805031 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3358C>T (p.Arg1120Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002929309] |
Chr16:88727136 [GRCh38] Chr16:88793544 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4567G>C (p.Asp1523His) |
single nucleotide variant |
Inborn genetic diseases [RCV002789200] |
Chr16:88722938 [GRCh38] Chr16:88789346 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2307C>G (p.His769Gln) |
single nucleotide variant |
not provided [RCV003082719] |
Chr16:88733928 [GRCh38] Chr16:88800336 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5747C>G (p.Ser1916Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002641098] |
Chr16:88720670 [GRCh38] Chr16:88787078 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6818G>A (p.Ser2273Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002875204] |
Chr16:88716667 [GRCh38] Chr16:88783075 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5482G>A (p.Glu1828Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002850272]|not provided [RCV003491281] |
Chr16:88721352 [GRCh38] Chr16:88787760 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1187G>A (p.Arg396Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002942237]|not provided [RCV002915072] |
Chr16:88737567 [GRCh38] Chr16:88803975 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.6827C>T (p.Ala2276Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002697357]|not provided [RCV003546871] |
Chr16:88716658 [GRCh38] Chr16:88783066 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.7292G>T (p.Ser2431Ile) |
single nucleotide variant |
not provided [RCV002508413] |
Chr16:88715957 [GRCh38] Chr16:88782365 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4957C>T (p.Arg1653Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002699622]|PIEZO1-related condition [RCV003918997]|not provided [RCV003111764]|not specified [RCV003493984] |
Chr16:88722065 [GRCh38] Chr16:88788473 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5639G>T (p.Gly1880Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002873926] |
Chr16:88721195 [GRCh38] Chr16:88787603 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5561C>A (p.Thr1854Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002826936] |
Chr16:88721273 [GRCh38] Chr16:88787681 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1745A>G (p.Tyr582Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002712677] |
Chr16:88734978 [GRCh38] Chr16:88801386 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5997G>T (p.Gln1999His) |
single nucleotide variant |
Inborn genetic diseases [RCV002916569] |
Chr16:88720236 [GRCh38] Chr16:88786644 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4210C>T (p.Arg1404Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002917790]|PIEZO1-related condition [RCV003936355]|not provided [RCV002917789] |
Chr16:88725033 [GRCh38] Chr16:88791441 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4451G>A (p.Ser1484Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002803461] |
Chr16:88723139 [GRCh38] Chr16:88789547 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2128G>C (p.Asp710His) |
single nucleotide variant |
Inborn genetic diseases [RCV002664756]|not provided [RCV003134692] |
Chr16:88734408 [GRCh38] Chr16:88800816 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.923T>C (p.Leu308Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002873582] |
Chr16:88738031 [GRCh38] Chr16:88804439 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.629T>A (p.Leu210Gln) |
single nucleotide variant |
not provided [RCV002667077] |
Chr16:88738573 [GRCh38] Chr16:88804981 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2699A>C (p.Glu900Ala) |
single nucleotide variant |
not provided [RCV002508434] |
Chr16:88732698 [GRCh38] Chr16:88799106 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7317-5del |
deletion |
not provided [RCV002508728] |
Chr16:88715859 [GRCh38] Chr16:88782267 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4822G>A (p.Gly1608Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002930850] |
Chr16:88722351 [GRCh38] Chr16:88788759 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4496-3_4499dup |
duplication |
not provided [RCV002711552] |
Chr16:88723005..88723006 [GRCh38] Chr16:88789413..88789414 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5029C>T (p.Arg1677Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV003003818]|not provided [RCV003410227] |
Chr16:88721993 [GRCh38] Chr16:88788401 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.176T>C (p.Leu59Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002954789] |
Chr16:88742407 [GRCh38] Chr16:88808815 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7219G>C (p.Glu2407Gln) |
single nucleotide variant |
Blood group, ER [RCV003152653]|Inborn genetic diseases [RCV002956136]|not provided [RCV003312085] |
Chr16:88716030 [GRCh38] Chr16:88782438 [GRCh37] Chr16:16q24.3 |
affects|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5810G>A (p.Gly1937Asp) |
single nucleotide variant |
Inborn genetic diseases [RCV002788361]|not provided [RCV003491275] |
Chr16:88720524 [GRCh38] Chr16:88786932 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2280C>T (p.Asp760=) |
single nucleotide variant |
not provided [RCV003082665] |
Chr16:88733955 [GRCh38] Chr16:88800363 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.289C>G (p.Arg97Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV002929754] |
Chr16:88742090 [GRCh38] Chr16:88808498 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1052G>C (p.Arg351Pro) |
single nucleotide variant |
not provided [RCV002626682] |
Chr16:88737783 [GRCh38] Chr16:88804191 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5744G>A (p.Arg1915His) |
single nucleotide variant |
Inborn genetic diseases [RCV002624110]|not provided [RCV002624109] |
Chr16:88720673 [GRCh38] Chr16:88787081 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7145A>G (p.Tyr2382Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004065926]|not provided [RCV002626549] |
Chr16:88716104 [GRCh38] Chr16:88782512 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4150G>A (p.Gly1384Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002789061] |
Chr16:88725428 [GRCh38] Chr16:88791836 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1981G>A (p.Gly661Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV002874203] |
Chr16:88734666 [GRCh38] Chr16:88801074 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3395C>T (p.Thr1132Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV002873249] |
Chr16:88727099 [GRCh38] Chr16:88793507 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4879G>A (p.Asp1627Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV002644605]|not provided [RCV003134688] |
Chr16:88722294 [GRCh38] Chr16:88788702 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5657C>T (p.Ala1886Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002916942] |
Chr16:88721177 [GRCh38] Chr16:88787585 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4211G>A (p.Arg1404Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV002802963] |
Chr16:88725032 [GRCh38] Chr16:88791440 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.161G>T (p.Gly54Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002742965] |
Chr16:88742422 [GRCh38] Chr16:88808830 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5047G>C (p.Val1683Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002793247] |
Chr16:88721975 [GRCh38] Chr16:88788383 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6990C>T (p.Pro2330=) |
single nucleotide variant |
not provided [RCV002900077] |
Chr16:88716420 [GRCh38] Chr16:88782828 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4420G>A (p.Ala1474Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002719656]|not provided [RCV003491309] |
Chr16:88723244 [GRCh38] Chr16:88789652 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2140G>A (p.Val714Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002921217] |
Chr16:88734396 [GRCh38] Chr16:88800804 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3312C>T (p.Leu1104=) |
single nucleotide variant |
PIEZO1-related condition [RCV003961316]|not provided [RCV002967274] |
Chr16:88727182 [GRCh38] Chr16:88793590 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.2181-14G>A |
single nucleotide variant |
not provided [RCV002576795] |
Chr16:88734068 [GRCh38] Chr16:88800476 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2035G>A (p.Glu679Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002718399] |
Chr16:88734501 [GRCh38] Chr16:88800909 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7369G>A (p.Gly2457Arg) |
single nucleotide variant |
not provided [RCV002633075] |
Chr16:88715802 [GRCh38] Chr16:88782210 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1842C>G (p.Leu614=) |
single nucleotide variant |
not provided [RCV002579303] |
Chr16:88734881 [GRCh38] Chr16:88801289 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2551C>T (p.Arg851Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV002652292] |
Chr16:88733391 [GRCh38] Chr16:88799799 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7555G>A (p.Glu2519Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002746906] |
Chr16:88715616 [GRCh38] Chr16:88782024 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.715C>A (p.Pro239Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004065715]|not provided [RCV002630185] |
Chr16:88738360 [GRCh38] Chr16:88804768 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.7129+12C>T |
single nucleotide variant |
not provided [RCV002597995] |
Chr16:88716186 [GRCh38] Chr16:88782594 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6829C>G (p.Leu2277Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002747110] |
Chr16:88716656 [GRCh38] Chr16:88783064 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5196G>A (p.Thr1732=) |
single nucleotide variant |
not provided [RCV002599525] |
Chr16:88721826 [GRCh38] Chr16:88788234 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3858C>G (p.Ile1286Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002921766] |
Chr16:88726394 [GRCh38] Chr16:88792802 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3223G>T (p.Val1075Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV002832554] |
Chr16:88727635 [GRCh38] Chr16:88794043 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2152G>C (p.Gly718Arg) |
single nucleotide variant |
not provided [RCV002671305] |
Chr16:88734384 [GRCh38] Chr16:88800792 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2404G>C (p.Val802Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002898233] |
Chr16:88733671 [GRCh38] Chr16:88800079 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5389C>T (p.Arg1797Cys) |
single nucleotide variant |
not provided [RCV003061622] |
Chr16:88721552 [GRCh38] Chr16:88787960 [GRCh37] Chr16:16q24.3 |
likely pathogenic|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5285G>A (p.Arg1762His) |
single nucleotide variant |
Inborn genetic diseases [RCV002961126] |
Chr16:88721656 [GRCh38] Chr16:88788064 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2385C>T (p.Phe795=) |
single nucleotide variant |
not provided [RCV002579302] |
Chr16:88733690 [GRCh38] Chr16:88800098 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5700G>C (p.Glu1900Asp) |
single nucleotide variant |
Inborn genetic diseases [RCV002855242] |
Chr16:88720717 [GRCh38] Chr16:88787125 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1528C>T (p.Arg510Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002964307]|not provided [RCV003135260] |
Chr16:88736177 [GRCh38] Chr16:88802585 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4675G>A (p.Glu1559Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002792691] |
Chr16:88722683 [GRCh38] Chr16:88789091 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1329C>T (p.Thr443=) |
single nucleotide variant |
not provided [RCV002579792] |
Chr16:88736376 [GRCh38] Chr16:88802784 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6323+18G>A |
single nucleotide variant |
not provided [RCV002581221] |
Chr16:88719784 [GRCh38] Chr16:88786192 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5863C>T (p.Arg1955Cys) |
single nucleotide variant |
not provided [RCV003064365] |
Chr16:88720471 [GRCh38] Chr16:88786879 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4529C>T (p.Thr1510Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002703099]|not provided [RCV003565577] |
Chr16:88722976 [GRCh38] Chr16:88789384 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5679C>T (p.Asp1893=) |
single nucleotide variant |
not provided [RCV002716322] |
Chr16:88720738 [GRCh38] Chr16:88787146 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3969-13C>T |
single nucleotide variant |
not provided [RCV002600964] |
Chr16:88725697 [GRCh38] Chr16:88792105 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4199G>A (p.Arg1400Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV002835613] |
Chr16:88725044 [GRCh38] Chr16:88791452 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.977C>T (p.Thr326Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002965213]|not provided [RCV003730332] |
Chr16:88737977 [GRCh38] Chr16:88804385 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.3325G>A (p.Ala1109Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002793035]|not provided [RCV003777772] |
Chr16:88727169 [GRCh38] Chr16:88793577 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4799T>C (p.Leu1600Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV002717990] |
Chr16:88722374 [GRCh38] Chr16:88788782 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4103G>A (p.Arg1368Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV004064424]|not provided [RCV002577101] |
Chr16:88725475 [GRCh38] Chr16:88791883 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.769G>A (p.Ala257Thr) |
single nucleotide variant |
not provided [RCV002599313] |
Chr16:88738306 [GRCh38] Chr16:88804714 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5867C>T (p.Ala1956Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002896039] |
Chr16:88720467 [GRCh38] Chr16:88786875 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1111G>A (p.Val371Met) |
single nucleotide variant |
Inborn genetic diseases [RCV002965536] |
Chr16:88737643 [GRCh38] Chr16:88804051 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4019G>A (p.Arg1340His) |
single nucleotide variant |
Inborn genetic diseases [RCV002714447]|not provided [RCV003130888] |
Chr16:88725634 [GRCh38] Chr16:88792042 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1763T>C (p.Phe588Ser) |
single nucleotide variant |
not provided [RCV003009378] |
Chr16:88734960 [GRCh38] Chr16:88801368 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.6597C>T (p.Ser2199=) |
single nucleotide variant |
not provided [RCV002580399] |
Chr16:88717086 [GRCh38] Chr16:88783494 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6079G>T (p.Val2027Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002855682] |
Chr16:88720154 [GRCh38] Chr16:88786562 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1009C>T (p.Pro337Ser) |
single nucleotide variant |
not provided [RCV002900389] |
Chr16:88737945 [GRCh38] Chr16:88804353 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3867C>T (p.Ser1289=) |
single nucleotide variant |
not provided [RCV002943134] |
Chr16:88726385 [GRCh38] Chr16:88792793 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5025G>A (p.Leu1675=) |
single nucleotide variant |
not provided [RCV002634822] |
Chr16:88721997 [GRCh38] Chr16:88788405 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3875T>G (p.Phe1292Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004071875]|not provided [RCV003093596] |
Chr16:88726377 [GRCh38] Chr16:88792785 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.2901T>A (p.Phe967Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002944352] |
Chr16:88732425 [GRCh38] Chr16:88798833 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1297-7C>T |
single nucleotide variant |
not provided [RCV003070328] |
Chr16:88736415 [GRCh38] Chr16:88802823 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6927-19G>A |
single nucleotide variant |
not provided [RCV002609816] |
Chr16:88716502 [GRCh38] Chr16:88782910 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1089G>A (p.Gln363=) |
single nucleotide variant |
not provided [RCV002608576] |
Chr16:88737746 [GRCh38] Chr16:88804154 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.463C>T (p.Leu155=) |
single nucleotide variant |
not provided [RCV002584510] |
Chr16:88741480 [GRCh38] Chr16:88807888 [GRCh37] Chr16:16q24.3 |
likely benign|conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.538C>G (p.Arg180Gly) |
single nucleotide variant |
not provided [RCV002608728] |
Chr16:88738664 [GRCh38] Chr16:88805072 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4776-21_4776-20del |
microsatellite |
not provided [RCV002589782] |
Chr16:88722417..88722418 [GRCh38] Chr16:88788825..88788826 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3432C>G (p.Pro1144=) |
single nucleotide variant |
not provided [RCV003092298] |
Chr16:88727062 [GRCh38] Chr16:88793470 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.328C>G (p.Leu110Val) |
single nucleotide variant |
Inborn genetic diseases [RCV002724255]|not provided [RCV003135229] |
Chr16:88741615 [GRCh38] Chr16:88808023 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3728T>C (p.Met1243Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV002657286] |
Chr16:88726615 [GRCh38] Chr16:88793023 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2923C>G (p.Leu975Val) |
single nucleotide variant |
not provided [RCV002607409] |
Chr16:88732403 [GRCh38] Chr16:88798811 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1006C>T (p.Arg336Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV002611169]|not provided [RCV002611170] |
Chr16:88737948 [GRCh38] Chr16:88804356 [GRCh37] Chr16:16q24.3 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5877C>T (p.Asp1959=) |
single nucleotide variant |
not provided [RCV003070060] |
Chr16:88720457 [GRCh38] Chr16:88786865 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6340T>C (p.Phe2114Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV002723512] |
Chr16:88719705 [GRCh38] Chr16:88786113 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2315C>T (p.Thr772Met) |
single nucleotide variant |
not provided [RCV003131914] |
Chr16:88733920 [GRCh38] Chr16:88800328 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5403G>A (p.Leu1801=) |
single nucleotide variant |
not provided [RCV003131917] |
Chr16:88721538 [GRCh38] Chr16:88787946 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2941G>A (p.Gly981Ser) |
single nucleotide variant |
not provided [RCV003131926] |
Chr16:88732385 [GRCh38] Chr16:88798793 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5765C>T (p.Ala1922Val) |
single nucleotide variant |
not provided [RCV003131931] |
Chr16:88720652 [GRCh38] Chr16:88787060 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4815C>G (p.Asp1605Glu) |
single nucleotide variant |
not provided [RCV003131934] |
Chr16:88722358 [GRCh38] Chr16:88788766 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5419G>A (p.Asp1807Asn) |
single nucleotide variant |
not provided [RCV003131939] |
Chr16:88721415 [GRCh38] Chr16:88787823 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4619G>A (p.Ser1540Asn) |
single nucleotide variant |
not provided [RCV003131944] |
Chr16:88722886 [GRCh38] Chr16:88789294 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5011C>T (p.Arg1671Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV003164831]|not provided [RCV003131946] |
Chr16:88722011 [GRCh38] Chr16:88788419 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3676A>G (p.Ile1226Val) |
single nucleotide variant |
not provided [RCV003131916] |
Chr16:88726738 [GRCh38] Chr16:88793146 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.245A>G (p.His82Arg) |
single nucleotide variant |
not provided [RCV003131933] |
Chr16:88742338 [GRCh38] Chr16:88808746 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1670-4del |
deletion |
not provided [RCV003131920] |
Chr16:88735057 [GRCh38] Chr16:88801465 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5393C>T (p.Ser1798Phe) |
single nucleotide variant |
not provided [RCV003131927] |
Chr16:88721548 [GRCh38] Chr16:88787956 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5482G>C (p.Glu1828Gln) |
single nucleotide variant |
not provided [RCV003131929] |
Chr16:88721352 [GRCh38] Chr16:88787760 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5423A>G (p.His1808Arg) |
single nucleotide variant |
not provided [RCV003131940] |
Chr16:88721411 [GRCh38] Chr16:88787819 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4838C>T (p.Thr1613Ile) |
single nucleotide variant |
not provided [RCV003131928] |
Chr16:88722335 [GRCh38] Chr16:88788743 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.601C>T (p.Arg201Trp) |
single nucleotide variant |
not provided [RCV003131930] |
Chr16:88738601 [GRCh38] Chr16:88805009 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4058A>T (p.Gln1353Leu) |
single nucleotide variant |
not provided [RCV003131932] |
Chr16:88725595 [GRCh38] Chr16:88792003 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4102C>T (p.Arg1368Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV003341542]|not provided [RCV003131935] |
Chr16:88725476 [GRCh38] Chr16:88791884 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6151G>A (p.Ala2051Thr) |
single nucleotide variant |
not provided [RCV003131937] |
Chr16:88720082 [GRCh38] Chr16:88786490 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5021G>A (p.Arg1674Gln) |
single nucleotide variant |
not provided [RCV003131941] |
Chr16:88722001 [GRCh38] Chr16:88788409 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4503C>A (p.Ser1501Arg) |
single nucleotide variant |
not provided [RCV003131942] |
Chr16:88723002 [GRCh38] Chr16:88789410 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3293A>G (p.Asn1098Ser) |
single nucleotide variant |
not provided [RCV003131943] |
Chr16:88727565 [GRCh38] Chr16:88793973 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4631G>A (p.Arg1544Gln) |
single nucleotide variant |
not provided [RCV003131945] |
Chr16:88722874 [GRCh38] Chr16:88789282 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6038G>C (p.Ser2013Thr) |
single nucleotide variant |
not provided [RCV003131947] |
Chr16:88720195 [GRCh38] Chr16:88786603 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.77G>A (p.Arg26His) |
single nucleotide variant |
not provided [RCV003131948] |
Chr16:88749467 [GRCh38] Chr16:88815875 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6973A>C (p.Met2325Leu) |
single nucleotide variant |
not provided [RCV003131949] |
Chr16:88716437 [GRCh38] Chr16:88782845 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3832C>A (p.Leu1278Met) |
single nucleotide variant |
not provided [RCV003131913] |
Chr16:88726420 [GRCh38] Chr16:88792828 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1821C>T (p.Leu607=) |
single nucleotide variant |
not provided [RCV003131915] |
Chr16:88734902 [GRCh38] Chr16:88801310 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7398T>C (p.Ile2466=) |
single nucleotide variant |
not provided [RCV003131921] |
Chr16:88715773 [GRCh38] Chr16:88782181 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3775A>T (p.Thr1259Ser) |
single nucleotide variant |
not provided [RCV003131922] |
Chr16:88726568 [GRCh38] Chr16:88792976 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.757G>A (p.Gly253Arg) |
single nucleotide variant |
not provided [RCV003131925] |
Chr16:88738318 [GRCh38] Chr16:88804726 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7141G>A (p.Asp2381Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV003254926] |
Chr16:88716108 [GRCh38] Chr16:88782516 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6055C>T (p.Arg2019Cys) |
single nucleotide variant |
PIEZO1-related condition [RCV003393126] |
Chr16:88720178 [GRCh38] Chr16:88786586 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4361A>G (p.Asn1454Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003299801] |
Chr16:88723303 [GRCh38] Chr16:88789711 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6823G>A (p.Gly2275Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV003201869] |
Chr16:88716662 [GRCh38] Chr16:88783070 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2399C>T (p.Ser800Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003195504] |
Chr16:88733676 [GRCh38] Chr16:88800084 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.572C>T (p.Thr191Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003197528]|not provided [RCV003491345] |
Chr16:88738630 [GRCh38] Chr16:88805038 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3400C>G (p.Arg1134Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV003205914] |
Chr16:88727094 [GRCh38] Chr16:88793502 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2973C>G (p.Phe991Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003205047] |
Chr16:88732353 [GRCh38] Chr16:88798761 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4727C>T (p.Thr1576Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003204746] |
Chr16:88722631 [GRCh38] Chr16:88789039 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.355A>C (p.Ile119Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003220293] |
Chr16:88741588 [GRCh38] Chr16:88807996 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5513C>A (p.Thr1838Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV003212523] |
Chr16:88721321 [GRCh38] Chr16:88787729 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6634G>A (p.Val2212Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003191168]|not provided [RCV003481466] |
Chr16:88717049 [GRCh38] Chr16:88783457 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4340C>T (p.Ala1447Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003191131]|not provided [RCV003992752] |
Chr16:88723324 [GRCh38] Chr16:88789732 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1787G>A (p.Arg596His) |
single nucleotide variant |
Inborn genetic diseases [RCV003203278] |
Chr16:88734936 [GRCh38] Chr16:88801344 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5820G>A (p.Arg1940=) |
single nucleotide variant |
not provided [RCV003222885] |
Chr16:88720514 [GRCh38] Chr16:88786922 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3641T>C (p.Leu1214Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV003206102] |
Chr16:88726773 [GRCh38] Chr16:88793181 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7283G>C (p.Ser2428Thr) |
single nucleotide variant |
not provided [RCV003134835] |
Chr16:88715966 [GRCh38] Chr16:88782374 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6279C>A (p.Phe2093Leu) |
single nucleotide variant |
not provided [RCV003134836] |
Chr16:88719846 [GRCh38] Chr16:88786254 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1721G>A (p.Gly574Asp) |
single nucleotide variant |
not provided [RCV003134838] |
Chr16:88735002 [GRCh38] Chr16:88801410 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5111C>A (p.Ser1704Tyr) |
single nucleotide variant |
not provided [RCV003134839] |
Chr16:88721911 [GRCh38] Chr16:88788319 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4820T>C (p.Met1607Thr) |
single nucleotide variant |
not provided [RCV003134840] |
Chr16:88722353 [GRCh38] Chr16:88788761 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.415T>G (p.Cys139Gly) |
single nucleotide variant |
not provided [RCV003134841] |
Chr16:88741528 [GRCh38] Chr16:88807936 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2392G>A (p.Val798Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV004246039]|PIEZO1-related condition [RCV003420570]|not provided [RCV003134842] |
Chr16:88733683 [GRCh38] Chr16:88800091 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3796C>A (p.Pro1266Thr) |
single nucleotide variant |
not provided [RCV003134843] |
Chr16:88726547 [GRCh38] Chr16:88792955 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5920A>G (p.Ile1974Val) |
single nucleotide variant |
not provided [RCV003134844] |
Chr16:88720414 [GRCh38] Chr16:88786822 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7481A>G (p.Glu2494Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003410270]|not provided [RCV003134845] |
Chr16:88715690 [GRCh38] Chr16:88782098 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4894G>A (p.Glu1632Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004246040]|not provided [RCV003134847] |
Chr16:88722279 [GRCh38] Chr16:88788687 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3487T>G (p.Phe1163Val) |
single nucleotide variant |
not provided [RCV003134848] |
Chr16:88726927 [GRCh38] Chr16:88793335 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3218G>A (p.Arg1073Gln) |
single nucleotide variant |
not provided [RCV003134849] |
Chr16:88727640 [GRCh38] Chr16:88794048 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6506A>T (p.Lys2169Met) |
single nucleotide variant |
not provided [RCV003134850] |
Chr16:88717177 [GRCh38] Chr16:88783585 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2813T>C (p.Leu938Pro) |
single nucleotide variant |
not provided [RCV003134851] |
Chr16:88732513 [GRCh38] Chr16:88798921 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5695G>T (p.Gly1899Trp) |
single nucleotide variant |
not provided [RCV003134852] |
Chr16:88720722 [GRCh38] Chr16:88787130 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3962C>T (p.Ala1321Val) |
single nucleotide variant |
not provided [RCV003134877] |
Chr16:88726290 [GRCh38] Chr16:88792698 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3976G>A (p.Ala1326Thr) |
single nucleotide variant |
not provided [RCV003134876] |
Chr16:88725677 [GRCh38] Chr16:88792085 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3818A>G (p.Asp1273Gly) |
single nucleotide variant |
not provided [RCV003134879] |
Chr16:88726434 [GRCh38] Chr16:88792842 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.2251G>C (p.Glu751Gln) |
single nucleotide variant |
not provided [RCV003134880] |
Chr16:88733984 [GRCh38] Chr16:88800392 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2593A>G (p.Ile865Val) |
single nucleotide variant |
not provided [RCV003134881] |
Chr16:88733349 [GRCh38] Chr16:88799757 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.226G>A (p.Ala76Thr) |
single nucleotide variant |
not provided [RCV003134882] |
Chr16:88742357 [GRCh38] Chr16:88808765 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4849A>C (p.Thr1617Pro) |
single nucleotide variant |
not provided [RCV003134883] |
Chr16:88722324 [GRCh38] Chr16:88788732 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5979C>G (p.Ser1993=) |
single nucleotide variant |
not provided [RCV003134884] |
Chr16:88720254 [GRCh38] Chr16:88786662 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4952A>C (p.Asp1651Ala) |
single nucleotide variant |
not provided [RCV003134885] |
Chr16:88722221 [GRCh38] Chr16:88788629 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5638G>T (p.Gly1880Cys) |
single nucleotide variant |
not provided [RCV003134887] |
Chr16:88721196 [GRCh38] Chr16:88787604 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5116G>A (p.Gly1706Ser) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003458254]|not provided [RCV003134888] |
Chr16:88721906 [GRCh38] Chr16:88788314 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.868T>C (p.Phe290Leu) |
single nucleotide variant |
not provided [RCV003134890] |
Chr16:88738086 [GRCh38] Chr16:88804494 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.421C>T (p.Arg141Cys) |
single nucleotide variant |
not provided [RCV003134891] |
Chr16:88741522 [GRCh38] Chr16:88807930 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6107C>T (p.Ala2036Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004246041]|not provided [RCV003134892] |
Chr16:88720126 [GRCh38] Chr16:88786534 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5878G>A (p.Val1960Ile) |
single nucleotide variant |
not provided [RCV003134893] |
Chr16:88720456 [GRCh38] Chr16:88786864 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7081C>T (p.Arg2361Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV003250850]|not provided [RCV003134894] |
Chr16:88716246 [GRCh38] Chr16:88782654 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5062_5063delinsCT (p.Glu1688Leu) |
indel |
not provided [RCV003134895] |
Chr16:88721959..88721960 [GRCh38] Chr16:88788367..88788368 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6785C>T (p.Pro2262Leu) |
single nucleotide variant |
not provided [RCV003134896] |
Chr16:88716700 [GRCh38] Chr16:88783108 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7420G>A (p.Val2474Met) |
single nucleotide variant |
not provided [RCV003134897] |
Chr16:88715751 [GRCh38] Chr16:88782159 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.5669-3C>T |
single nucleotide variant |
not provided [RCV003134898] |
Chr16:88720751 [GRCh38] Chr16:88787159 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.742C>T (p.Leu248Phe) |
single nucleotide variant |
not provided [RCV003134899] |
Chr16:88738333 [GRCh38] Chr16:88804741 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.440G>A (p.Arg147Gln) |
single nucleotide variant |
not provided [RCV003134900] |
Chr16:88741503 [GRCh38] Chr16:88807911 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3082C>T (p.Arg1028Cys) |
single nucleotide variant |
not provided [RCV003134901] |
Chr16:88731820 [GRCh38] Chr16:88798228 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2583G>T (p.Trp861Cys) |
single nucleotide variant |
not provided [RCV003134902] |
Chr16:88733359 [GRCh38] Chr16:88799767 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2801A>G (p.Gln934Arg) |
single nucleotide variant |
not provided [RCV003134875] |
Chr16:88732525 [GRCh38] Chr16:88798933 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1336C>A (p.Leu446Met) |
single nucleotide variant |
not provided [RCV003134874] |
Chr16:88736369 [GRCh38] Chr16:88802777 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3031A>G (p.Met1011Val) |
single nucleotide variant |
not provided [RCV003134873] |
Chr16:88731871 [GRCh38] Chr16:88798279 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1400C>T (p.Ser467Leu) |
single nucleotide variant |
not provided [RCV003134872] |
Chr16:88736305 [GRCh38] Chr16:88802713 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4117C>G (p.Arg1373Gly) |
single nucleotide variant |
not provided [RCV003134870] |
Chr16:88725461 [GRCh38] Chr16:88791869 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7157G>A (p.Arg2386His) |
single nucleotide variant |
PIEZO1-related condition [RCV003420571]|not provided [RCV003134869] |
Chr16:88716092 [GRCh38] Chr16:88782500 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5681G>A (p.Arg1894Lys) |
single nucleotide variant |
not provided [RCV003134868] |
Chr16:88720736 [GRCh38] Chr16:88787144 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.7081C>A (p.Arg2361Ser) |
single nucleotide variant |
not provided [RCV003134867] |
Chr16:88716246 [GRCh38] Chr16:88782654 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4640G>A (p.Arg1547His) |
single nucleotide variant |
not provided [RCV003134866] |
Chr16:88722865 [GRCh38] Chr16:88789273 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.6576_6590del (p.Phe2193_Val2197del) |
deletion |
not provided [RCV003134865] |
Chr16:88717093..88717107 [GRCh38] Chr16:88783501..88783515 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5840A>C (p.His1947Pro) |
single nucleotide variant |
not provided [RCV003134864] |
Chr16:88720494 [GRCh38] Chr16:88786902 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.827C>T (p.Pro276Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003259382] |
Chr16:88738248 [GRCh38] Chr16:88804656 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.106C>T (p.Leu36Phe) |
single nucleotide variant |
not provided [RCV003134863] |
Chr16:88749438 [GRCh38] Chr16:88815846 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2697G>T (p.Thr899=) |
single nucleotide variant |
not provided [RCV003134862] |
Chr16:88732700 [GRCh38] Chr16:88799108 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.844G>C (p.Ala282Pro) |
single nucleotide variant |
not provided [RCV003134861] |
Chr16:88738231 [GRCh38] Chr16:88804639 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6411G>A (p.Met2137Ile) |
single nucleotide variant |
not provided [RCV003134860] |
Chr16:88719634 [GRCh38] Chr16:88786042 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4066C>T (p.Arg1356Cys) |
single nucleotide variant |
not provided [RCV003134859] |
Chr16:88725512 [GRCh38] Chr16:88791920 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4784G>A (p.Gly1595Asp) |
single nucleotide variant |
not provided [RCV003134858] |
Chr16:88722389 [GRCh38] Chr16:88788797 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1208G>A (p.Arg403Gln) |
single nucleotide variant |
not provided [RCV003134857] |
Chr16:88736727 [GRCh38] Chr16:88803135 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3022G>C (p.Gly1008Arg) |
single nucleotide variant |
not provided [RCV003134856] |
Chr16:88731880 [GRCh38] Chr16:88798288 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3988G>A (p.Ala1330Thr) |
single nucleotide variant |
not provided [RCV003134855] |
Chr16:88725665 [GRCh38] Chr16:88792073 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2641_2643del (p.Glu881del) |
deletion |
not provided [RCV003134854] |
Chr16:88733299..88733301 [GRCh38] Chr16:88799707..88799709 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6214A>C (p.Ile2072Leu) |
single nucleotide variant |
not provided [RCV003134853] |
Chr16:88719911 [GRCh38] Chr16:88786319 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6868C>T (p.Arg2290Trp) |
single nucleotide variant |
not provided [RCV003134878] |
Chr16:88716617 [GRCh38] Chr16:88783025 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2165C>T (p.Pro722Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003155903]|not provided [RCV003561201] |
Chr16:88734371 [GRCh38] Chr16:88800779 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.1297-2A>G |
single nucleotide variant |
not provided [RCV003135665] |
Chr16:88736410 [GRCh38] Chr16:88802818 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.5718dup (p.Thr1907fs) |
duplication |
not provided [RCV003135666] |
Chr16:88720698..88720699 [GRCh38] Chr16:88787106..88787107 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.5395C>T (p.Gln1799Ter) |
single nucleotide variant |
not provided [RCV003135667] |
Chr16:88721546 [GRCh38] Chr16:88787954 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1352G>A (p.Cys451Tyr) |
single nucleotide variant |
Inborn genetic diseases [RCV003197284] |
Chr16:88736353 [GRCh38] Chr16:88802761 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3913C>T (p.His1305Tyr) |
single nucleotide variant |
not provided [RCV003142666] |
Chr16:88726339 [GRCh38] Chr16:88792747 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3001C>G (p.Leu1001Val) |
single nucleotide variant |
not provided [RCV003142667] |
Chr16:88731901 [GRCh38] Chr16:88798309 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1531T>G (p.Tyr511Asp) |
single nucleotide variant |
not provided [RCV003142668] |
Chr16:88736174 [GRCh38] Chr16:88802582 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6584C>T (p.Ser2195Leu) |
single nucleotide variant |
not provided [RCV003142669] |
Chr16:88717099 [GRCh38] Chr16:88783507 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.468TGA[2] (p.Asp158del) |
microsatellite |
not provided [RCV003142670] |
Chr16:88738726..88738728 [GRCh38] Chr16:88805134..88805136 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4195C>T (p.Arg1399Trp) |
single nucleotide variant |
not provided [RCV003142672] |
Chr16:88725048 [GRCh38] Chr16:88791456 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2404G>A (p.Val802Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003269549]|not provided [RCV003142673] |
Chr16:88733671 [GRCh38] Chr16:88800079 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.707G>C (p.Cys236Ser) |
single nucleotide variant |
not provided [RCV003142674] |
Chr16:88738368 [GRCh38] Chr16:88804776 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4118G>A (p.Arg1373His) |
single nucleotide variant |
not provided [RCV003142675] |
Chr16:88725460 [GRCh38] Chr16:88791868 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5701G>A (p.Glu1901Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV003197794] |
Chr16:88720716 [GRCh38] Chr16:88787124 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4492G>A (p.Ala1498Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV003175662] |
Chr16:88723098 [GRCh38] Chr16:88789506 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3025C>T (p.Gln1009Ter) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003140287] |
Chr16:88731877 [GRCh38] Chr16:88798285 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7488G>C (p.Glu2496Asp) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003140283] |
Chr16:88715683 [GRCh38] Chr16:88782091 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.612dup (p.Val205fs) |
duplication |
Lymphatic malformation 6 [RCV003140284] |
Chr16:88738589..88738590 [GRCh38] Chr16:88804997..88804998 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.7415C>T (p.Pro2472Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003180684]|not provided [RCV003992751] |
Chr16:88715756 [GRCh38] Chr16:88782164 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4672G>A (p.Gly1558Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003192700] |
Chr16:88722686 [GRCh38] Chr16:88789094 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001012759.3(CTU2):c.1432C>A (p.Pro478Thr) |
single nucleotide variant |
not provided [RCV003223882] |
Chr16:88715060 [GRCh38] Chr16:88781468 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3055G>A (p.Gly1019Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003196723] |
Chr16:88731847 [GRCh38] Chr16:88798255 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.140C>G (p.Pro47Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV003214379] |
Chr16:88749404 [GRCh38] Chr16:88815812 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5590C>T (p.Arg1864Cys) |
single nucleotide variant |
not provided [RCV003225355] |
Chr16:88721244 [GRCh38] Chr16:88787652 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.5438C>T (p.Pro1813Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003207969] |
Chr16:88721396 [GRCh38] Chr16:88787804 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5181G>C (p.Lys1727Asn) |
single nucleotide variant |
not specified [RCV003322306] |
Chr16:88721841 [GRCh38] Chr16:88788249 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4246G>A (p.Gly1416Arg) |
single nucleotide variant |
not specified [RCV003322307] |
Chr16:88723960 [GRCh38] Chr16:88790368 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.870C>G (p.Phe290Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV003309628] |
Chr16:88738084 [GRCh38] Chr16:88804492 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1960G>C (p.Ala654Pro) |
single nucleotide variant |
not specified [RCV003320511] |
Chr16:88734687 [GRCh38] Chr16:88801095 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5602C>G (p.Arg1868Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003397240] |
Chr16:88721232 [GRCh38] Chr16:88787640 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4015C>T (p.His1339Tyr) |
single nucleotide variant |
Inborn genetic diseases [RCV003339982] |
Chr16:88725638 [GRCh38] Chr16:88792046 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4241A>G (p.His1414Arg) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003338026] |
Chr16:88723965 [GRCh38] Chr16:88790373 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4964G>A (p.Arg1655His) |
single nucleotide variant |
Inborn genetic diseases [RCV003381396] |
Chr16:88722058 [GRCh38] Chr16:88788466 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2539T>C (p.Tyr847His) |
single nucleotide variant |
Inborn genetic diseases [RCV003376923] |
Chr16:88733403 [GRCh38] Chr16:88799811 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5413C>G (p.Leu1805Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003420829] |
Chr16:88721421 [GRCh38] Chr16:88787829 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3781A>C (p.Lys1261Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV003374319] |
Chr16:88726562 [GRCh38] Chr16:88792970 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5816A>G (p.Tyr1939Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV003370394] |
Chr16:88720518 [GRCh38] Chr16:88786926 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.428C>G (p.Ala143Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003393156] |
Chr16:88741515 [GRCh38] Chr16:88807923 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3886C>A (p.Leu1296Met) |
single nucleotide variant |
Inborn genetic diseases [RCV003365164] |
Chr16:88726366 [GRCh38] Chr16:88792774 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3559C>G (p.Leu1187Val) |
single nucleotide variant |
Inborn genetic diseases [RCV003366546] |
Chr16:88726855 [GRCh38] Chr16:88793263 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3907C>T (p.Leu1303Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV003386836] |
Chr16:88726345 [GRCh38] Chr16:88792753 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5353T>C (p.Tyr1785His) |
single nucleotide variant |
Inborn genetic diseases [RCV003374278] |
Chr16:88721588 [GRCh38] Chr16:88787996 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2737C>T (p.Pro913Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV003370492] |
Chr16:88732660 [GRCh38] Chr16:88799068 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5072_5074del (p.Cys1691del) |
deletion |
Lymphatic malformation 6 [RCV003458285] |
Chr16:88721948..88721950 [GRCh38] Chr16:88788356..88788358 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6482A>G (p.Gln2161Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV003372137] |
Chr16:88717201 [GRCh38] Chr16:88783609 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.167C>T (p.Thr56Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV003352186] |
Chr16:88742416 [GRCh38] Chr16:88808824 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4316C>T (p.Ser1439Leu) |
single nucleotide variant |
not provided [RCV003563331] |
Chr16:88723890 [GRCh38] Chr16:88790298 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1296+6C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003919244]|not provided [RCV003456952] |
Chr16:88736633 [GRCh38] Chr16:88803041 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1828C>T (p.Leu610Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV004364891]|not provided [RCV003488204] |
Chr16:88734895 [GRCh38] Chr16:88801303 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7333G>A (p.Val2445Met) |
single nucleotide variant |
not provided [RCV003488243] |
Chr16:88715838 [GRCh38] Chr16:88782246 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.4018C>T (p.Arg1340Cys) |
single nucleotide variant |
not provided [RCV003488255] |
Chr16:88725635 [GRCh38] Chr16:88792043 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6384C>T (p.Asp2128=) |
single nucleotide variant |
not provided [RCV003712572] |
Chr16:88719661 [GRCh38] Chr16:88786069 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4607A>G (p.His1536Arg) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003458282] |
Chr16:88722898 [GRCh38] Chr16:88789306 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3397G>A (p.Asp1133Asn) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003458289] |
Chr16:88727097 [GRCh38] Chr16:88793505 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4956-17C>T |
single nucleotide variant |
not provided [RCV003736368] |
Chr16:88722083 [GRCh38] Chr16:88788491 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.1211C>T (p.Ala404Val) |
single nucleotide variant |
not provided [RCV003736455] |
Chr16:88736724 [GRCh38] Chr16:88803132 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1917G>C (p.Leu639=) |
single nucleotide variant |
not provided [RCV003736498] |
Chr16:88734730 [GRCh38] Chr16:88801138 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6927-20C>T |
single nucleotide variant |
not provided [RCV003872573] |
Chr16:88716503 [GRCh38] Chr16:88782911 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3458C>G (p.Ser1153Cys) |
single nucleotide variant |
not provided [RCV003480216] |
Chr16:88726956 [GRCh38] Chr16:88793364 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2748G>A (p.Trp916Ter) |
single nucleotide variant |
not provided [RCV003480322] |
Chr16:88732649 [GRCh38] Chr16:88799057 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.4382G>A (p.Arg1461Gln) |
single nucleotide variant |
not provided [RCV003480210] |
Chr16:88723282 [GRCh38] Chr16:88789690 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.469G>C (p.Asp157His) |
single nucleotide variant |
PIEZO1-related condition [RCV003954291]|not provided [RCV003571146] |
Chr16:88738733 [GRCh38] Chr16:88805141 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.4928G>A (p.Arg1643Gln) |
single nucleotide variant |
not provided [RCV003874979] |
Chr16:88722245 [GRCh38] Chr16:88788653 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7348_7359dup (p.Lys2453_Phe2454insValIleGlyLys) |
duplication |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003494508] |
Chr16:88715811..88715812 [GRCh38] Chr16:88782219..88782220 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6494AGA[3] (p.Lys2168_Lys2169del) |
microsatellite |
not provided [RCV003488207] |
Chr16:88717175..88717180 [GRCh38] Chr16:88783583..88783588 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4748C>T (p.Ala1583Val) |
single nucleotide variant |
not provided [RCV003488235] |
Chr16:88722610 [GRCh38] Chr16:88789018 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1913T>C (p.Met638Thr) |
single nucleotide variant |
not provided [RCV003488251] |
Chr16:88734734 [GRCh38] Chr16:88801142 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6019A>T (p.Met2007Leu) |
single nucleotide variant |
not provided [RCV003488253] |
Chr16:88720214 [GRCh38] Chr16:88786622 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3433G>A (p.Val1145Met) |
single nucleotide variant |
not provided [RCV003740553] |
Chr16:88727061 [GRCh38] Chr16:88793469 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2156C>T (p.Thr719Met) |
single nucleotide variant |
not provided [RCV003488226] |
Chr16:88734380 [GRCh38] Chr16:88800788 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3277_3278delinsA (p.Ala1093fs) |
indel |
not provided [RCV003489402] |
Chr16:88727580..88727581 [GRCh38] Chr16:88793988..88793989 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
GRCh37/hg19 16q24.2-24.3(chr16:88067200-89460290)x1 |
copy number loss |
not provided [RCV003483304] |
Chr16:88067200..89460290 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2764G>T (p.Gly922Trp) |
single nucleotide variant |
PIEZO1-related condition [RCV003419149] |
Chr16:88732633 [GRCh38] Chr16:88799041 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3700-18_3700-17insGCTGGCCCT |
microsatellite |
not provided [RCV003872566] |
Chr16:88726660..88726661 [GRCh38] Chr16:88793068..88793069 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1195+2T>G |
single nucleotide variant |
not provided [RCV003480224] |
Chr16:88737557 [GRCh38] Chr16:88803965 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2559G>A (p.Met853Ile) |
single nucleotide variant |
Lymphatic malformation 6 [RCV003458330] |
Chr16:88733383 [GRCh38] Chr16:88799791 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2447A>G (p.Lys816Arg) |
single nucleotide variant |
PIEZO1-related condition [RCV003399504]|not provided [RCV003491376] |
Chr16:88733628 [GRCh38] Chr16:88800036 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.353C>G (p.Ala118Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003399639] |
Chr16:88741590 [GRCh38] Chr16:88807998 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.402C>T (p.Val134=) |
single nucleotide variant |
not provided [RCV003426905] |
Chr16:88741541 [GRCh38] Chr16:88807949 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1534C>T (p.Pro512Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV004364847]|not provided [RCV003480222] |
Chr16:88736171 [GRCh38] Chr16:88802579 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1364C>T (p.Thr455Met) |
single nucleotide variant |
not provided [RCV003480223] |
Chr16:88736341 [GRCh38] Chr16:88802749 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_001142864.4(PIEZO1):c.7463G>A (p.Arg2488Gln) |
single nucleotide variant |
not provided [RCV003480317] |
Chr16:88715708 [GRCh38] Chr16:88782116 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1536del (p.Cys513fs) |
deletion |
not provided [RCV003480328] |
Chr16:88736169 [GRCh38] Chr16:88802577 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1450_1453del (p.Trp484fs) |
deletion |
not provided [RCV003480331] |
Chr16:88736252..88736255 [GRCh38] Chr16:88802660..88802663 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6412T>G (p.Cys2138Gly) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003448849] |
Chr16:88719633 [GRCh38] Chr16:88786041 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2227_2241del (p.Glu743_Gln747del) |
deletion |
not provided [RCV003480220] |
Chr16:88733994..88734008 [GRCh38] Chr16:88800402..88800416 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3969-8C>G |
single nucleotide variant |
PIEZO1-related condition [RCV003946639]|not provided [RCV003480214] |
Chr16:88725692 [GRCh38] Chr16:88792100 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.7234C>T (p.Arg2412Trp) |
single nucleotide variant |
not provided [RCV003480206] |
Chr16:88716015 [GRCh38] Chr16:88782423 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88647290-88859285)x1 |
copy number loss |
not provided [RCV003483306] |
Chr16:88647290..88859285 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3797-3C>T |
single nucleotide variant |
not provided [RCV003480215] |
Chr16:88726458 [GRCh38] Chr16:88792866 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6446T>A (p.Ile2149Asn) |
single nucleotide variant |
not provided [RCV003480208] |
Chr16:88719599 [GRCh38] Chr16:88786007 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2293G>C (p.Val765Leu) |
single nucleotide variant |
not provided [RCV003691108] |
Chr16:88733942 [GRCh38] Chr16:88800350 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2330-9_2330-2dup |
duplication |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003447816] |
Chr16:88733746..88733747 [GRCh38] Chr16:88800154..88800155 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7368C>T (p.Arg2456=) |
single nucleotide variant |
PIEZO1-related condition [RCV003966372]|not provided [RCV003426894] |
Chr16:88715803 [GRCh38] Chr16:88782211 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6264C>T (p.Arg2088=) |
single nucleotide variant |
not provided [RCV003426895] |
Chr16:88719861 [GRCh38] Chr16:88786269 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5802G>A (p.Leu1934=) |
single nucleotide variant |
not provided [RCV003426897] |
Chr16:88720532 [GRCh38] Chr16:88786940 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4350A>G (p.Ala1450=) |
single nucleotide variant |
not provided [RCV003426899] |
Chr16:88723314 [GRCh38] Chr16:88789722 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.668A>T (p.Tyr223Phe) |
single nucleotide variant |
not provided [RCV003426904] |
Chr16:88738407 [GRCh38] Chr16:88804815 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2247GGA[5] (p.Glu754_Glu756del) |
microsatellite |
not provided [RCV003488205] |
Chr16:88733965..88733973 [GRCh38] Chr16:88800373..88800381 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7093G>A (p.Gly2365Arg) |
single nucleotide variant |
not provided [RCV003488215] |
Chr16:88716234 [GRCh38] Chr16:88782642 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3096G>C (p.Gln1032His) |
single nucleotide variant |
not provided [RCV003488225] |
Chr16:88731806 [GRCh38] Chr16:88798214 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4351T>C (p.Trp1451Arg) |
single nucleotide variant |
not provided [RCV003488233] |
Chr16:88723313 [GRCh38] Chr16:88789721 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7168C>T (p.Arg2390Trp) |
single nucleotide variant |
not provided [RCV003488237] |
Chr16:88716081 [GRCh38] Chr16:88782489 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6899C>T (p.Thr2300Ile) |
single nucleotide variant |
not provided [RCV003488238] |
Chr16:88716586 [GRCh38] Chr16:88782994 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.695C>G (p.Thr232Ser) |
single nucleotide variant |
not provided [RCV003488240] |
Chr16:88738380 [GRCh38] Chr16:88804788 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5556C>G (p.Asp1852Glu) |
single nucleotide variant |
not provided [RCV003488241] |
Chr16:88721278 [GRCh38] Chr16:88787686 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4685G>A (p.Arg1562Lys) |
single nucleotide variant |
not provided [RCV003488250] |
Chr16:88722673 [GRCh38] Chr16:88789081 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.674del (p.Leu225fs) |
deletion |
PIEZO1-related condition [RCV003394412] |
Chr16:88738401 [GRCh38] Chr16:88804809 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.4530G>A (p.Thr1510=) |
single nucleotide variant |
not provided [RCV003419496] |
Chr16:88722975 [GRCh38] Chr16:88789383 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5282G>A (p.Arg1761Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003420842] |
Chr16:88721659 [GRCh38] Chr16:88788067 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2914C>T (p.Arg972Cys) |
single nucleotide variant |
not provided [RCV003480218] |
Chr16:88732412 [GRCh38] Chr16:88798820 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3322T>G (p.Cys1108Gly) |
single nucleotide variant |
not provided [RCV003480217] |
Chr16:88727172 [GRCh38] Chr16:88793580 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4196G>A (p.Arg1399Gln) |
single nucleotide variant |
not provided [RCV003480213] |
Chr16:88725047 [GRCh38] Chr16:88791455 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4270G>A (p.Asp1424Asn) |
single nucleotide variant |
not provided [RCV003480212] |
Chr16:88723936 [GRCh38] Chr16:88790344 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5218G>A (p.Ala1740Thr) |
single nucleotide variant |
PIEZO1-related condition [RCV003402638] |
Chr16:88721723 [GRCh38] Chr16:88788131 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4939G>A (p.Glu1647Lys) |
single nucleotide variant |
not provided [RCV003426898] |
Chr16:88722234 [GRCh38] Chr16:88788642 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3179C>T (p.Pro1060Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003419001] |
Chr16:88731723 [GRCh38] Chr16:88798131 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2410G>A (p.Val804Met) |
single nucleotide variant |
PIEZO1-related condition [RCV003399737] |
Chr16:88733665 [GRCh38] Chr16:88800073 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7149C>T (p.Leu2383=) |
single nucleotide variant |
PIEZO1-related condition [RCV003946553]|not provided [RCV003419490] |
Chr16:88716100 [GRCh38] Chr16:88782508 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6381G>A (p.Thr2127=) |
single nucleotide variant |
not provided [RCV003419492] |
Chr16:88719664 [GRCh38] Chr16:88786072 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5652A>G (p.Lys1884=) |
single nucleotide variant |
not provided [RCV003419493] |
Chr16:88721182 [GRCh38] Chr16:88787590 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4965C>T (p.Arg1655=) |
single nucleotide variant |
not provided [RCV003419495] |
Chr16:88722057 [GRCh38] Chr16:88788465 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.305C>T (p.Ser102Leu) |
single nucleotide variant |
not provided [RCV003419498] |
Chr16:88742074 [GRCh38] Chr16:88808482 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6064T>C (p.Tyr2022His) |
single nucleotide variant |
PIEZO1-related condition [RCV003391515] |
Chr16:88720169 [GRCh38] Chr16:88786577 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6811G>C (p.Glu2271Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003400288] |
Chr16:88716674 [GRCh38] Chr16:88783082 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6398T>C (p.Leu2133Pro) |
single nucleotide variant |
not provided [RCV003419491] |
Chr16:88719647 [GRCh38] Chr16:88786055 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5553G>A (p.Thr1851=) |
single nucleotide variant |
not provided [RCV003419494] |
Chr16:88721281 [GRCh38] Chr16:88787689 [GRCh37] Chr16:16q24.3 |
likely benign |
Single allele |
deletion |
KBG syndrome [RCV003388955] |
Chr16:88621654..89376245 [GRCh38] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.1792G>C (p.Val598Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003412334] |
Chr16:88734931 [GRCh38] Chr16:88801339 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7261G>A (p.Val2421Ile) |
single nucleotide variant |
PIEZO1-related condition [RCV003421146] |
Chr16:88715988 [GRCh38] Chr16:88782396 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6349G>A (p.Glu2117Lys) |
single nucleotide variant |
PIEZO1-related condition [RCV003391663] |
Chr16:88719696 [GRCh38] Chr16:88786104 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.3330C>T (p.Ser1110=) |
single nucleotide variant |
not provided [RCV003426901] |
Chr16:88727164 [GRCh38] Chr16:88793572 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3026A>T (p.Gln1009Leu) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003388676] |
Chr16:88731876 [GRCh38] Chr16:88798284 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6008C>A (p.Ala2003Asp) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003444070]|PIEZO1-related condition [RCV003406082] |
Chr16:88720225 [GRCh38] Chr16:88786633 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6473A>T (p.Lys2158Ile) |
single nucleotide variant |
not provided [RCV003456951] |
Chr16:88717210 [GRCh38] Chr16:88783618 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3359G>A (p.Arg1120His) |
single nucleotide variant |
not provided [RCV003441562] |
Chr16:88727135 [GRCh38] Chr16:88793543 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3855C>G (p.Ile1285Met) |
single nucleotide variant |
PIEZO1-related condition [RCV003406164] |
Chr16:88726397 [GRCh38] Chr16:88792805 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5012G>A (p.Arg1671Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003414479]|not provided [RCV003778246] |
Chr16:88722010 [GRCh38] Chr16:88788418 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4328C>A (p.Ala1443Asp) |
single nucleotide variant |
PIEZO1-related condition [RCV003416735] |
Chr16:88723878 [GRCh38] Chr16:88790286 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1718A>G (p.Lys573Arg) |
single nucleotide variant |
PIEZO1-related condition [RCV003410728]|not provided [RCV003481506] |
Chr16:88735005 [GRCh38] Chr16:88801413 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2157_2180+28del |
deletion |
PIEZO1-related condition [RCV003405907] |
Chr16:88734328..88734379 [GRCh38] Chr16:88800736..88800787 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.4072C>T (p.Arg1358Cys) |
single nucleotide variant |
PIEZO1-related condition [RCV003414547] |
Chr16:88725506 [GRCh38] Chr16:88791914 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6073_6074del (p.Lys2025fs) |
deletion |
not provided [RCV003426896] |
Chr16:88720159..88720160 [GRCh38] Chr16:88786567..88786568 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3798C>T (p.Pro1266=) |
single nucleotide variant |
PIEZO1-related condition [RCV003954152]|not provided [RCV003426900] |
Chr16:88726454 [GRCh38] Chr16:88792862 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6598G>C (p.Val2200Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003406084] |
Chr16:88717085 [GRCh38] Chr16:88783493 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.570C>T (p.Val190=) |
single nucleotide variant |
not provided [RCV003413031] |
Chr16:88738632 [GRCh38] Chr16:88805040 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.753G>A (p.Ala251=) |
single nucleotide variant |
not provided [RCV003413030] |
Chr16:88738322 [GRCh38] Chr16:88804730 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1992C>T (p.Asp664=) |
single nucleotide variant |
not provided [RCV003413029] |
Chr16:88734655 [GRCh38] Chr16:88801063 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4994T>C (p.Phe1665Ser) |
single nucleotide variant |
not provided [RCV003413028] |
Chr16:88722028 [GRCh38] Chr16:88788436 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1086C>T (p.Pro362=) |
single nucleotide variant |
not provided [RCV003426903] |
Chr16:88737749 [GRCh38] Chr16:88804157 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.772G>A (p.Gly258Ser) |
single nucleotide variant |
PIEZO1-related condition [RCV003419057] |
Chr16:88738303 [GRCh38] Chr16:88804711 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1684C>G (p.Gln562Glu) |
single nucleotide variant |
PIEZO1-related condition [RCV003394340] |
Chr16:88735039 [GRCh38] Chr16:88801447 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3734C>T (p.Thr1245Ile) |
single nucleotide variant |
not provided [RCV003419497] |
Chr16:88726609 [GRCh38] Chr16:88793017 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1918G>A (p.Val640Ile) |
single nucleotide variant |
not provided [RCV003426902] |
Chr16:88734729 [GRCh38] Chr16:88801137 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7049+9A>T |
single nucleotide variant |
PIEZO1-related condition [RCV003410654] |
Chr16:88716352 [GRCh38] Chr16:88782760 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7226A>C (p.Gln2409Pro) |
single nucleotide variant |
PIEZO1-related condition [RCV003400092] |
Chr16:88716023 [GRCh38] Chr16:88782431 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5758G>C (p.Val1920Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003399825] |
Chr16:88720659 [GRCh38] Chr16:88787067 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2738C>T (p.Pro913Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003410881] |
Chr16:88732659 [GRCh38] Chr16:88799067 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3815G>C (p.Arg1272Thr) |
single nucleotide variant |
PIEZO1-related condition [RCV003405946] |
Chr16:88726437 [GRCh38] Chr16:88792845 [GRCh37] Chr16:16q24.3 |
uncertain significance |
Single allele |
deletion |
KBG syndrome [RCV003388954] |
Chr16:88197484..89331695 [GRCh38] Chr16:16q24.2-24.3 |
pathogenic |
Single allele |
deletion |
KBG syndrome [RCV003388953] |
Chr16:87169884..89487487 [GRCh38] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.3373C>T (p.Gln1125Ter) |
single nucleotide variant |
PIEZO1-related condition [RCV003403050]|not provided [RCV003699100] |
Chr16:88727121 [GRCh38] Chr16:88793529 [GRCh37] Chr16:16q24.3 |
pathogenic|likely pathogenic |
NM_001142864.4(PIEZO1):c.6882C>T (p.Asn2294=) |
single nucleotide variant |
not provided [RCV003545569] |
Chr16:88716603 [GRCh38] Chr16:88783011 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6835C>T (p.Arg2279Cys) |
single nucleotide variant |
not provided [RCV003488203] |
Chr16:88716650 [GRCh38] Chr16:88783058 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5827C>T (p.Arg1943Trp) |
single nucleotide variant |
not provided [RCV003488247] |
Chr16:88720507 [GRCh38] Chr16:88786915 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.1361G>A (p.Trp454Ter) |
single nucleotide variant |
not provided [RCV003690693] |
Chr16:88736344 [GRCh38] Chr16:88802752 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.6472-12G>A |
single nucleotide variant |
not provided [RCV003881595] |
Chr16:88717223 [GRCh38] Chr16:88783631 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2926G>A (p.Asp976Asn) |
single nucleotide variant |
not provided [RCV003488219] |
Chr16:88732400 [GRCh38] Chr16:88798808 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4387_4392del (p.Gln1463_Gln1464del) |
deletion |
not provided [RCV003488223] |
Chr16:88723272..88723277 [GRCh38] Chr16:88789680..88789685 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3868G>T (p.Val1290Phe) |
single nucleotide variant |
not provided [RCV003488239] |
Chr16:88726384 [GRCh38] Chr16:88792792 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6640C>G (p.Leu2214Val) |
single nucleotide variant |
not provided [RCV003488249] |
Chr16:88717043 [GRCh38] Chr16:88783451 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3520G>C (p.Val1174Leu) |
single nucleotide variant |
not provided [RCV003488252] |
Chr16:88726894 [GRCh38] Chr16:88793302 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3301+18C>A |
single nucleotide variant |
not provided [RCV003714891] |
Chr16:88727539 [GRCh38] Chr16:88793947 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7231T>G (p.Cys2411Gly) |
single nucleotide variant |
not provided [RCV003882009] |
Chr16:88716018 [GRCh38] Chr16:88782426 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1829T>G (p.Leu610Arg) |
single nucleotide variant |
not provided [RCV003577666] |
Chr16:88734894 [GRCh38] Chr16:88801302 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.344del (p.Ile115fs) |
deletion |
not provided [RCV003489401] |
Chr16:88741599 [GRCh38] Chr16:88808007 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.6067C>G (p.Leu2023Val) |
single nucleotide variant |
not provided [RCV003489403] |
Chr16:88720166 [GRCh38] Chr16:88786574 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.1196-8A>G |
single nucleotide variant |
not provided [RCV003831762] |
Chr16:88736747 [GRCh38] Chr16:88803155 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5296A>C (p.Lys1766Gln) |
single nucleotide variant |
not specified [RCV003494183] |
Chr16:88721645 [GRCh38] Chr16:88788053 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2882T>G (p.Leu961Arg) |
single nucleotide variant |
not provided [RCV003694805] |
Chr16:88732444 [GRCh38] Chr16:88798852 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.257G>A (p.Arg86His) |
single nucleotide variant |
not provided [RCV003544822] |
Chr16:88742326 [GRCh38] Chr16:88808734 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6392T>C (p.Leu2131Pro) |
single nucleotide variant |
Polyhydramnios [RCV003494423] |
Chr16:88719653 [GRCh38] Chr16:88786061 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2661C>T (p.Thr887=) |
single nucleotide variant |
not provided [RCV003553483] |
Chr16:88733281 [GRCh38] Chr16:88799689 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.5559G>A (p.Gly1853=) |
single nucleotide variant |
not provided [RCV003659958] |
Chr16:88721275 [GRCh38] Chr16:88787683 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1296+34CCTCTGCCGCGCAGGTGTGGGGCATCGCCTGGGTGGGGTGCGCTGGGCAGCTGTGCAGCCC[2] |
microsatellite |
not provided [RCV003880367] |
Chr16:88736423..88736483 [GRCh38] Chr16:88802831..88802891 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2407C>G (p.Gln803Glu) |
single nucleotide variant |
not provided [RCV003488202] |
Chr16:88733668 [GRCh38] Chr16:88800076 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.600G>A (p.Gly200=) |
single nucleotide variant |
not provided [RCV003882118] |
Chr16:88738602 [GRCh38] Chr16:88805010 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2207T>C (p.Leu736Pro) |
single nucleotide variant |
not provided [RCV003488206] |
Chr16:88734028 [GRCh38] Chr16:88800436 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2942G>A (p.Gly981Asp) |
single nucleotide variant |
not provided [RCV003488209] |
Chr16:88732384 [GRCh38] Chr16:88798792 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5992G>A (p.Asp1998Asn) |
single nucleotide variant |
not provided [RCV003488213] |
Chr16:88720241 [GRCh38] Chr16:88786649 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3707C>T (p.Ala1236Val) |
single nucleotide variant |
not provided [RCV003488214] |
Chr16:88726636 [GRCh38] Chr16:88793044 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.253C>T (p.Pro85Ser) |
single nucleotide variant |
not provided [RCV003488221] |
Chr16:88742330 [GRCh38] Chr16:88808738 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2966T>A (p.Phe989Tyr) |
single nucleotide variant |
not provided [RCV003488224] |
Chr16:88732360 [GRCh38] Chr16:88798768 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4406_4416delinsAG (p.Ala1469_Gln1471del) |
indel |
not provided [RCV003488228] |
Chr16:88723248..88723258 [GRCh38] Chr16:88789656..88789666 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.308G>A (p.Arg103Gln) |
single nucleotide variant |
not provided [RCV003488242] |
Chr16:88742071 [GRCh38] Chr16:88808479 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1291A>T (p.Met431Leu) |
single nucleotide variant |
not provided [RCV003488248] |
Chr16:88736644 [GRCh38] Chr16:88803052 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3585C>A (p.Tyr1195Ter) |
single nucleotide variant |
not provided [RCV003575405] |
Chr16:88726829 [GRCh38] Chr16:88793237 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.4945C>G (p.Leu1649Val) |
single nucleotide variant |
not provided [RCV003576727] |
Chr16:88722228 [GRCh38] Chr16:88788636 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4932G>T (p.Thr1644=) |
single nucleotide variant |
not provided [RCV003547893] |
Chr16:88722241 [GRCh38] Chr16:88788649 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1233G>A (p.Pro411=) |
single nucleotide variant |
not provided [RCV003577937] |
Chr16:88736702 [GRCh38] Chr16:88803110 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1303A>G (p.Ser435Gly) |
single nucleotide variant |
not specified [RCV003494119] |
Chr16:88736402 [GRCh38] Chr16:88802810 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3699+14C>G |
single nucleotide variant |
not provided [RCV003829284] |
Chr16:88726701 [GRCh38] Chr16:88793109 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1195+9C>T |
single nucleotide variant |
not provided [RCV003739700] |
Chr16:88737550 [GRCh38] Chr16:88803958 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.834C>T (p.Ala278=) |
single nucleotide variant |
not provided [RCV003577984] |
Chr16:88738241 [GRCh38] Chr16:88804649 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4061T>G (p.Met1354Arg) |
single nucleotide variant |
not provided [RCV003574174] |
Chr16:88725517 [GRCh38] Chr16:88791925 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2403C>T (p.Arg801=) |
single nucleotide variant |
not provided [RCV003545412] |
Chr16:88733672 [GRCh38] Chr16:88800080 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1101T>C (p.Ser367=) |
single nucleotide variant |
not provided [RCV003739175] |
Chr16:88737734 [GRCh38] Chr16:88804142 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5681G>C (p.Arg1894Thr) |
single nucleotide variant |
not provided [RCV003488211] |
Chr16:88720736 [GRCh38] Chr16:88787144 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5719A>G (p.Thr1907Ala) |
single nucleotide variant |
not provided [RCV003488212] |
Chr16:88720698 [GRCh38] Chr16:88787106 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4027GAG[1] (p.Glu1344del) |
microsatellite |
not provided [RCV003488217] |
Chr16:88725621..88725623 [GRCh38] Chr16:88792029..88792031 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2585C>T (p.Thr862Ile) |
single nucleotide variant |
not provided [RCV003488220] |
Chr16:88733357 [GRCh38] Chr16:88799765 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7271G>C (p.Ser2424Thr) |
single nucleotide variant |
not provided [RCV003488227] |
Chr16:88715978 [GRCh38] Chr16:88782386 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5866G>A (p.Ala1956Thr) |
single nucleotide variant |
not provided [RCV003488245] |
Chr16:88720468 [GRCh38] Chr16:88786876 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5776C>T (p.Arg1926Trp) |
single nucleotide variant |
not provided [RCV003488254] |
Chr16:88720641 [GRCh38] Chr16:88787049 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1163T>C (p.Leu388Pro) |
single nucleotide variant |
not provided [RCV003577230] |
Chr16:88737591 [GRCh38] Chr16:88803999 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5099T>C (p.Met1700Thr) |
single nucleotide variant |
not provided [RCV003878289] |
Chr16:88721923 [GRCh38] Chr16:88788331 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4478C>T (p.Pro1493Leu) |
single nucleotide variant |
not provided [RCV003878313] |
Chr16:88723112 [GRCh38] Chr16:88789520 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2992-7T>A |
single nucleotide variant |
not provided [RCV003545561] |
Chr16:88731917 [GRCh38] Chr16:88798325 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3699+11G>A |
single nucleotide variant |
not provided [RCV003881083] |
Chr16:88726704 [GRCh38] Chr16:88793112 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4542G>A (p.Leu1514=) |
single nucleotide variant |
not provided [RCV003877682] |
Chr16:88722963 [GRCh38] Chr16:88789371 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1682C>T (p.Thr561Met) |
single nucleotide variant |
not provided [RCV003488229] |
Chr16:88735041 [GRCh38] Chr16:88801449 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5792G>C (p.Cys1931Ser) |
single nucleotide variant |
not provided [RCV003688011] |
Chr16:88720625 [GRCh38] Chr16:88787033 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4123_4140del (p.Gln1375_Pro1380del) |
deletion |
not provided [RCV003546439] |
Chr16:88725438..88725455 [GRCh38] Chr16:88791846..88791863 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6754-3C>T |
single nucleotide variant |
not provided [RCV003690990] |
Chr16:88716734 [GRCh38] Chr16:88783142 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4235-20_4235-19del |
microsatellite |
not provided [RCV003879726] |
Chr16:88723990..88723991 [GRCh38] Chr16:88790398..88790399 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.849-18C>T |
single nucleotide variant |
not provided [RCV003714648] |
Chr16:88738123 [GRCh38] Chr16:88804531 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.497C>T (p.Pro166Leu) |
single nucleotide variant |
not provided [RCV003545847] |
Chr16:88738705 [GRCh38] Chr16:88805113 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4234+10A>C |
single nucleotide variant |
not provided [RCV003714686] |
Chr16:88724999 [GRCh38] Chr16:88791407 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.283+8G>A |
single nucleotide variant |
not provided [RCV003663444] |
Chr16:88742292 [GRCh38] Chr16:88808700 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2664+3A>G |
single nucleotide variant |
not provided [RCV003488200] |
Chr16:88733275 [GRCh38] Chr16:88799683 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4856G>A (p.Ser1619Asn) |
single nucleotide variant |
not provided [RCV003488201] |
Chr16:88722317 [GRCh38] Chr16:88788725 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2627T>A (p.Val876Asp) |
single nucleotide variant |
not provided [RCV003488208] |
Chr16:88733315 [GRCh38] Chr16:88799723 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5035G>A (p.Val1679Met) |
single nucleotide variant |
not provided [RCV003488210] |
Chr16:88721987 [GRCh38] Chr16:88788395 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4084_4086del (p.Glu1362del) |
deletion |
not provided [RCV003488218] |
Chr16:88725492..88725494 [GRCh38] Chr16:88791900..88791902 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6784C>G (p.Pro2262Ala) |
single nucleotide variant |
not provided [RCV003488222] |
Chr16:88716701 [GRCh38] Chr16:88783109 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4600C>T (p.Arg1534Trp) |
single nucleotide variant |
not provided [RCV003488230] |
Chr16:88722905 [GRCh38] Chr16:88789313 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5862C>T (p.Tyr1954=) |
single nucleotide variant |
not provided [RCV003488231] |
Chr16:88720472 [GRCh38] Chr16:88786880 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3364G>A (p.Glu1122Lys) |
single nucleotide variant |
not provided [RCV003488232] |
Chr16:88727130 [GRCh38] Chr16:88793538 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3925C>T (p.His1309Tyr) |
single nucleotide variant |
not provided [RCV003488234] |
Chr16:88726327 [GRCh38] Chr16:88792735 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2009T>G (p.Leu670Arg) |
single nucleotide variant |
not provided [RCV003488236] |
Chr16:88734527 [GRCh38] Chr16:88800935 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5249G>C (p.Gly1750Ala) |
single nucleotide variant |
not provided [RCV003488244] |
Chr16:88721692 [GRCh38] Chr16:88788100 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2764G>C (p.Gly922Arg) |
single nucleotide variant |
not provided [RCV003488246] |
Chr16:88732633 [GRCh38] Chr16:88799041 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5991C>T (p.Asp1997=) |
single nucleotide variant |
not provided [RCV003561499] |
Chr16:88720242 [GRCh38] Chr16:88786650 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.359G>A (p.Arg120Gln) |
single nucleotide variant |
not provided [RCV003488216] |
Chr16:88741584 [GRCh38] Chr16:88807992 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.2247GGA[10] (p.Glu756_Asp757insGluGlu) |
microsatellite |
PIEZO1-related condition [RCV003946650]|not provided [RCV003545497] |
Chr16:88733964..88733965 [GRCh38] Chr16:88800372..88800373 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.172C>T (p.Arg58Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004369091]|not provided [RCV003546206] |
Chr16:88742411 [GRCh38] Chr16:88808819 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.768C>T (p.Gly256=) |
single nucleotide variant |
PIEZO1-related condition [RCV003939064]|not provided [RCV003547046] |
Chr16:88738307 [GRCh38] Chr16:88804715 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4426C>G (p.Gln1476Glu) |
single nucleotide variant |
not provided [RCV003852322] |
Chr16:88723238 [GRCh38] Chr16:88789646 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2956T>G (p.Phe986Val) |
single nucleotide variant |
not provided [RCV003716862] |
Chr16:88732370 [GRCh38] Chr16:88798778 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2911A>G (p.Thr971Ala) |
single nucleotide variant |
not provided [RCV003740604] |
Chr16:88732415 [GRCh38] Chr16:88798823 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7366C>A (p.Arg2456Ser) |
single nucleotide variant |
not provided [RCV003740585] |
Chr16:88715805 [GRCh38] Chr16:88782213 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4955+19C>G |
single nucleotide variant |
not provided [RCV003740620] |
Chr16:88722199 [GRCh38] Chr16:88788607 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1049C>T (p.Ala350Val) |
single nucleotide variant |
not provided [RCV003548382] |
Chr16:88737786 [GRCh38] Chr16:88804194 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1107+6C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003929223]|not provided [RCV003548389] |
Chr16:88737722 [GRCh38] Chr16:88804130 [GRCh37] Chr16:16q24.3 |
likely benign|uncertain significance |
NM_001142864.4(PIEZO1):c.4167C>T (p.Pro1389=) |
single nucleotide variant |
not provided [RCV003836150] |
Chr16:88725076 [GRCh38] Chr16:88791484 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6443T>C (p.Ile2148Thr) |
single nucleotide variant |
not provided [RCV003717480] |
Chr16:88719602 [GRCh38] Chr16:88786010 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.1780G>A (p.Ala594Thr) |
single nucleotide variant |
not provided [RCV003548682] |
Chr16:88734943 [GRCh38] Chr16:88801351 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5632A>G (p.Lys1878Glu) |
single nucleotide variant |
not provided [RCV003559398] |
Chr16:88721202 [GRCh38] Chr16:88787610 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.64+7G>C |
single nucleotide variant |
PIEZO1-related condition [RCV003966666]|not provided [RCV003740516] |
Chr16:88784894 [GRCh38] Chr16:88851302 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6223G>A (p.Ala2075Thr) |
single nucleotide variant |
not provided [RCV003718051] |
Chr16:88719902 [GRCh38] Chr16:88786310 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4163-11C>G |
single nucleotide variant |
not provided [RCV003812212] |
Chr16:88725091 [GRCh38] Chr16:88791499 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1877T>C (p.Leu626Pro) |
single nucleotide variant |
not provided [RCV003740587] |
Chr16:88734770 [GRCh38] Chr16:88801178 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3700-18_3700-17insCCCCGCTGGCCCCGCTGA |
insertion |
not provided [RCV003740596] |
Chr16:88726660..88726661 [GRCh38] Chr16:88793068..88793069 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.466-16T>C |
single nucleotide variant |
not provided [RCV003740619] |
Chr16:88738752 [GRCh38] Chr16:88805160 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7151G>C (p.Gly2384Ala) |
single nucleotide variant |
not provided [RCV003740625] |
Chr16:88716098 [GRCh38] Chr16:88782506 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4998G>A (p.Ala1666=) |
single nucleotide variant |
PIEZO1-related condition [RCV003949013]|not provided [RCV003740626] |
Chr16:88722024 [GRCh38] Chr16:88788432 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2008C>T (p.Leu670=) |
single nucleotide variant |
not provided [RCV003560785] |
Chr16:88734528 [GRCh38] Chr16:88800936 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2991+13C>T |
single nucleotide variant |
not provided [RCV003669522] |
Chr16:88732322 [GRCh38] Chr16:88798730 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3983A>C (p.Tyr1328Ser) |
single nucleotide variant |
not provided [RCV003740510] |
Chr16:88725670 [GRCh38] Chr16:88792078 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5355C>T (p.Tyr1785=) |
single nucleotide variant |
not provided [RCV003724823] |
Chr16:88721586 [GRCh38] Chr16:88787994 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6803C>T (p.Ala2268Val) |
single nucleotide variant |
not provided [RCV003740546] |
Chr16:88716682 [GRCh38] Chr16:88783090 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3864C>T (p.Asp1288=) |
single nucleotide variant |
not provided [RCV003740560] |
Chr16:88726388 [GRCh38] Chr16:88792796 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6926+5G>A |
single nucleotide variant |
not provided [RCV003740641] |
Chr16:88716554 [GRCh38] Chr16:88782962 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.327-8C>G |
single nucleotide variant |
not provided [RCV003703409] |
Chr16:88741624 [GRCh38] Chr16:88808032 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5902G>A (p.Asp1968Asn) |
single nucleotide variant |
not provided [RCV003672909] |
Chr16:88720432 [GRCh38] Chr16:88786840 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.466-7T>G |
single nucleotide variant |
not provided [RCV003663834] |
Chr16:88738743 [GRCh38] Chr16:88805151 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4122C>T (p.Pro1374=) |
single nucleotide variant |
not provided [RCV003666828] |
Chr16:88725456 [GRCh38] Chr16:88791864 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4816G>A (p.Asp1606Asn) |
single nucleotide variant |
not provided [RCV003817104] |
Chr16:88722357 [GRCh38] Chr16:88788765 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3797-17C>T |
single nucleotide variant |
not provided [RCV003837002] |
Chr16:88726472 [GRCh38] Chr16:88792880 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7434C>G (p.Leu2478=) |
single nucleotide variant |
not provided [RCV003702282] |
Chr16:88715737 [GRCh38] Chr16:88782145 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3220G>A (p.Ala1074Thr) |
single nucleotide variant |
not provided [RCV003726134] |
Chr16:88727638 [GRCh38] Chr16:88794046 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5653G>A (p.Gly1885Arg) |
single nucleotide variant |
not provided [RCV003674192] |
Chr16:88721181 [GRCh38] Chr16:88787589 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5801+12C>T |
single nucleotide variant |
not provided [RCV003814254] |
Chr16:88720604 [GRCh38] Chr16:88787012 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.112C>T (p.Leu38=) |
single nucleotide variant |
not provided [RCV003740503] |
Chr16:88749432 [GRCh38] Chr16:88815840 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2168G>A (p.Arg723His) |
single nucleotide variant |
not provided [RCV003837128] |
Chr16:88734368 [GRCh38] Chr16:88800776 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2991+15T>C |
single nucleotide variant |
not provided [RCV003740653] |
Chr16:88732320 [GRCh38] Chr16:88798728 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4927C>G (p.Arg1643Gly) |
single nucleotide variant |
not provided [RCV003558182] |
Chr16:88722246 [GRCh38] Chr16:88788654 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5885C>T (p.Ala1962Val) |
single nucleotide variant |
not provided [RCV003698464] |
Chr16:88720449 [GRCh38] Chr16:88786857 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.466G>A (p.Asp156Asn) |
single nucleotide variant |
not provided [RCV003668868] |
Chr16:88738736 [GRCh38] Chr16:88805144 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6342C>G (p.Phe2114Leu) |
single nucleotide variant |
not provided [RCV003740579] |
Chr16:88719703 [GRCh38] Chr16:88786111 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7239C>A (p.Thr2413=) |
single nucleotide variant |
not provided [RCV003667520] |
Chr16:88716010 [GRCh38] Chr16:88782418 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1428G>A (p.Thr476=) |
single nucleotide variant |
not provided [RCV003740603] |
Chr16:88736277 [GRCh38] Chr16:88802685 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4840G>A (p.Gly1614Ser) |
single nucleotide variant |
not provided [RCV003566505] |
Chr16:88722333 [GRCh38] Chr16:88788741 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1195+15C>G |
single nucleotide variant |
not provided [RCV003840658] |
Chr16:88737544 [GRCh38] Chr16:88803952 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5034C>T (p.Ala1678=) |
single nucleotide variant |
not provided [RCV003552982] |
Chr16:88721988 [GRCh38] Chr16:88788396 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4234+17C>T |
single nucleotide variant |
not provided [RCV003820974] |
Chr16:88724992 [GRCh38] Chr16:88791400 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1930G>A (p.Val644Ile) |
single nucleotide variant |
not provided [RCV003556804] |
Chr16:88734717 [GRCh38] Chr16:88801125 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4287G>A (p.Glu1429=) |
single nucleotide variant |
not provided [RCV003736190] |
Chr16:88723919 [GRCh38] Chr16:88790327 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.130T>A (p.Phe44Ile) |
single nucleotide variant |
not provided [RCV003728816] |
Chr16:88749414 [GRCh38] Chr16:88815822 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5846T>G (p.Ile1949Ser) |
single nucleotide variant |
not provided [RCV003728759] |
Chr16:88720488 [GRCh38] Chr16:88786896 [GRCh37] Chr16:16q24.3 |
conflicting interpretations of pathogenicity |
NM_001142864.4(PIEZO1):c.5807A>G (p.Gln1936Arg) |
single nucleotide variant |
not provided [RCV003563330] |
Chr16:88720527 [GRCh38] Chr16:88786935 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5603G>A (p.Arg1868His) |
single nucleotide variant |
not provided [RCV003731415] |
Chr16:88721231 [GRCh38] Chr16:88787639 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2180+10dup |
duplication |
not provided [RCV003862065] |
Chr16:88734345..88734346 [GRCh38] Chr16:88800753..88800754 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4148C>G (p.Pro1383Arg) |
single nucleotide variant |
not provided [RCV003679257] |
Chr16:88725430 [GRCh38] Chr16:88791838 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1775G>C (p.Ser592Thr) |
single nucleotide variant |
not provided [RCV003705806] |
Chr16:88734948 [GRCh38] Chr16:88801356 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6019A>C (p.Met2007Leu) |
single nucleotide variant |
not provided [RCV003727164] |
Chr16:88720214 [GRCh38] Chr16:88786622 [GRCh37] Chr16:16q24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.2395C>T (p.Leu799Phe) |
single nucleotide variant |
not provided [RCV003556828] |
Chr16:88733680 [GRCh38] Chr16:88800088 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4496-6C>G |
single nucleotide variant |
not provided [RCV003729912] |
Chr16:88723015 [GRCh38] Chr16:88789423 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.766G>A (p.Gly256Ser) |
single nucleotide variant |
not provided [RCV003729430] |
Chr16:88738309 [GRCh38] Chr16:88804717 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6041C>T (p.Thr2014Ile) |
single nucleotide variant |
not provided [RCV003842992] |
Chr16:88720192 [GRCh38] Chr16:88786600 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2415C>T (p.Phe805=) |
single nucleotide variant |
not provided [RCV003680924] |
Chr16:88733660 [GRCh38] Chr16:88800068 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6751C>T (p.Pro2251Ser) |
single nucleotide variant |
not provided [RCV003733529] |
Chr16:88716808 [GRCh38] Chr16:88783216 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2004G>T (p.Gly668=) |
single nucleotide variant |
not provided [RCV003557226] |
Chr16:88734532 [GRCh38] Chr16:88800940 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.307C>G (p.Arg103Gly) |
single nucleotide variant |
not provided [RCV003722035] |
Chr16:88742072 [GRCh38] Chr16:88808480 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1299A>G (p.Val433=) |
single nucleotide variant |
not provided [RCV003720377] |
Chr16:88736406 [GRCh38] Chr16:88802814 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3441C>T (p.Asn1147=) |
single nucleotide variant |
not provided [RCV003737504] |
Chr16:88727053 [GRCh38] Chr16:88793461 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.2285G>A (p.Gly762Glu) |
single nucleotide variant |
Inborn genetic diseases [RCV004369626]|not provided [RCV003871356] |
Chr16:88733950 [GRCh38] Chr16:88800358 [GRCh37] Chr16:16q24.3 |
benign|uncertain significance |
NM_001142864.4(PIEZO1):c.2552G>A (p.Arg851Gln) |
single nucleotide variant |
not provided [RCV003728899] |
Chr16:88733390 [GRCh38] Chr16:88799798 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4955+16G>T |
single nucleotide variant |
not provided [RCV003736487] |
Chr16:88722202 [GRCh38] Chr16:88788610 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4620C>T (p.Ser1540=) |
single nucleotide variant |
not provided [RCV003736490] |
Chr16:88722885 [GRCh38] Chr16:88789293 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.284-15C>G |
single nucleotide variant |
not provided [RCV003736499] |
Chr16:88742110 [GRCh38] Chr16:88808518 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.557C>G (p.Ala186Gly) |
single nucleotide variant |
not provided [RCV003736500] |
Chr16:88738645 [GRCh38] Chr16:88805053 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2415C>A (p.Phe805Leu) |
single nucleotide variant |
not provided [RCV003736502] |
Chr16:88733660 [GRCh38] Chr16:88800068 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1314C>T (p.Tyr438=) |
single nucleotide variant |
not provided [RCV003736510] |
Chr16:88736391 [GRCh38] Chr16:88802799 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2180+11G>A |
single nucleotide variant |
not provided [RCV003736514] |
Chr16:88734345 [GRCh38] Chr16:88800753 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5742C>A (p.Ser1914Arg) |
single nucleotide variant |
not provided [RCV003872312] |
Chr16:88720675 [GRCh38] Chr16:88787083 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6661-14C>T |
single nucleotide variant |
not provided [RCV003872315] |
Chr16:88716912 [GRCh38] Chr16:88783320 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7150G>A (p.Gly2384Ser) |
single nucleotide variant |
not provided [RCV003719776] |
Chr16:88716099 [GRCh38] Chr16:88782507 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5668+9G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003929303]|not provided [RCV003720016] |
Chr16:88721157 [GRCh38] Chr16:88787565 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7316+10T>C |
single nucleotide variant |
PIEZO1-related condition [RCV003892313] |
Chr16:88715923 [GRCh38] Chr16:88782331 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7130-10T>C |
single nucleotide variant |
not provided [RCV003737137] |
Chr16:88716129 [GRCh38] Chr16:88782537 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5826A>G (p.Leu1942=) |
single nucleotide variant |
PIEZO1-related condition [RCV003892282] |
Chr16:88720508 [GRCh38] Chr16:88786916 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5481C>T (p.Ala1827=) |
single nucleotide variant |
not provided [RCV003719900] |
Chr16:88721353 [GRCh38] Chr16:88787761 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6150C>T (p.Pro2050=) |
single nucleotide variant |
PIEZO1-related condition [RCV003948955]|not provided [RCV003719928] |
Chr16:88720083 [GRCh38] Chr16:88786491 [GRCh37] Chr16:16q24.3 |
likely benign |
GRCh37/hg19 16q24.2-24.3(chr16:88445361-88818583)x3 |
copy number gain |
not specified [RCV003987174] |
Chr16:88445361..88818583 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2530G>A (p.Ala844Thr) |
single nucleotide variant |
not provided [RCV003869843] |
Chr16:88733412 [GRCh38] Chr16:88799820 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5214+17G>C |
single nucleotide variant |
not provided [RCV003845376] |
Chr16:88721791 [GRCh38] Chr16:88788199 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2338A>C (p.Lys780Gln) |
single nucleotide variant |
not provided [RCV003705398] |
Chr16:88733737 [GRCh38] Chr16:88800145 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4701G>A (p.Gln1567=) |
single nucleotide variant |
not provided [RCV003719573] |
Chr16:88722657 [GRCh38] Chr16:88789065 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.5691_5705del (p.Glu1898_Glu1902del) |
deletion |
not provided [RCV003721634] |
Chr16:88720712..88720726 [GRCh38] Chr16:88787120..88787134 [GRCh37] Chr16:16q24.3 |
uncertain significance |
GRCh37/hg19 16q24.2-24.3(chr16:88153961-89104917)x1 |
copy number loss |
not specified [RCV003987173] |
Chr16:88153961..89104917 [GRCh37] Chr16:16q24.2-24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2673C>T (p.Pro891=) |
single nucleotide variant |
PIEZO1-related condition [RCV003901355]|not provided [RCV003729057] |
Chr16:88732724 [GRCh38] Chr16:88799132 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.6108G>T (p.Ala2036=) |
single nucleotide variant |
PIEZO1-related condition [RCV003956554]|not provided [RCV003736392] |
Chr16:88720125 [GRCh38] Chr16:88786533 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1152C>T (p.Ile384=) |
single nucleotide variant |
not provided [RCV003736393] |
Chr16:88737602 [GRCh38] Chr16:88804010 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4775+17C>T |
single nucleotide variant |
not provided [RCV003736395] |
Chr16:88722566 [GRCh38] Chr16:88788974 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3324C>T (p.Cys1108=) |
single nucleotide variant |
not provided [RCV003736411] |
Chr16:88727170 [GRCh38] Chr16:88793578 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.64+12dup |
duplication |
not provided [RCV003848595] |
Chr16:88784888..88784889 [GRCh38] Chr16:88851296..88851297 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.7522C>A (p.Arg2508Ser) |
single nucleotide variant |
not provided [RCV003736441] |
Chr16:88715649 [GRCh38] Chr16:88782057 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4785C>T (p.Gly1595=) |
single nucleotide variant |
not provided [RCV003736448] |
Chr16:88722388 [GRCh38] Chr16:88788796 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5706G>A (p.Glu1902=) |
single nucleotide variant |
not provided [RCV003736476] |
Chr16:88720711 [GRCh38] Chr16:88787119 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5598G>A (p.Thr1866=) |
single nucleotide variant |
not provided [RCV003736482] |
Chr16:88721236 [GRCh38] Chr16:88787644 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1819C>T (p.Leu607Phe) |
single nucleotide variant |
not provided [RCV003736485] |
Chr16:88734904 [GRCh38] Chr16:88801312 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3501C>T (p.Phe1167=) |
single nucleotide variant |
not provided [RCV003736525] |
Chr16:88726913 [GRCh38] Chr16:88793321 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2152G>A (p.Gly718Ser) |
single nucleotide variant |
not provided [RCV003736470] |
Chr16:88734384 [GRCh38] Chr16:88800792 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2460G>A (p.Leu820=) |
single nucleotide variant |
PIEZO1-related condition [RCV003981120]|not provided [RCV003736460] |
Chr16:88733615 [GRCh38] Chr16:88800023 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.920G>A (p.Gly307Asp) |
single nucleotide variant |
not provided [RCV003736457] |
Chr16:88738034 [GRCh38] Chr16:88804442 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3578G>T (p.Cys1193Phe) |
single nucleotide variant |
not provided [RCV003733415] |
Chr16:88726836 [GRCh38] Chr16:88793244 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.6998C>G (p.Thr2333Ser) |
single nucleotide variant |
not provided [RCV003865759] |
Chr16:88716412 [GRCh38] Chr16:88782820 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5098A>G (p.Met1700Val) |
single nucleotide variant |
not provided [RCV003736417] |
Chr16:88721924 [GRCh38] Chr16:88788332 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6519C>T (p.Tyr2173=) |
single nucleotide variant |
not provided [RCV003736423] |
Chr16:88717164 [GRCh38] Chr16:88783572 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4024A>T (p.Ile1342Leu) |
single nucleotide variant |
not provided [RCV003556918] |
Chr16:88725629 [GRCh38] Chr16:88792037 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7128C>T (p.Pro2376=) |
single nucleotide variant |
not provided [RCV003820654] |
Chr16:88716199 [GRCh38] Chr16:88782607 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5762G>C (p.Arg1921Thr) |
single nucleotide variant |
not provided [RCV003710518] |
Chr16:88720655 [GRCh38] Chr16:88787063 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5774G>A (p.Arg1925Gln) |
single nucleotide variant |
not provided [RCV003551199] |
Chr16:88720643 [GRCh38] Chr16:88787051 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.4164G>A (p.Gly1388=) |
single nucleotide variant |
not provided [RCV003843303] |
Chr16:88725079 [GRCh38] Chr16:88791487 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2652C>T (p.Ser884=) |
single nucleotide variant |
PIEZO1-related condition [RCV003909161]|not provided [RCV003819931] |
Chr16:88733290 [GRCh38] Chr16:88799698 [GRCh37] Chr16:16q24.3 |
benign|likely benign |
NM_001142864.4(PIEZO1):c.3699+20G>A |
single nucleotide variant |
not provided [RCV003845467] |
Chr16:88726695 [GRCh38] Chr16:88793103 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3711C>T (p.Cys1237=) |
single nucleotide variant |
not provided [RCV003733110] |
Chr16:88726632 [GRCh38] Chr16:88793040 [GRCh37] Chr16:16q24.3 |
benign |
NM_001142864.4(PIEZO1):c.3491G>C (p.Arg1164Pro) |
single nucleotide variant |
not provided [RCV003541796] |
Chr16:88726923 [GRCh38] Chr16:88793331 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2375C>T (p.Ala792Val) |
single nucleotide variant |
not provided [RCV003861428] |
Chr16:88733700 [GRCh38] Chr16:88800108 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6940G>A (p.Gly2314Arg) |
single nucleotide variant |
not provided [RCV003541795] |
Chr16:88716470 [GRCh38] Chr16:88782878 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1108-5C>T |
single nucleotide variant |
not provided [RCV003734323] |
Chr16:88737651 [GRCh38] Chr16:88804059 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6662C>T (p.Pro2221Leu) |
single nucleotide variant |
not provided [RCV003822845] |
Chr16:88716897 [GRCh38] Chr16:88783305 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2330-6T>C |
single nucleotide variant |
not provided [RCV003993098] |
Chr16:88733751 [GRCh38] Chr16:88800159 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2544A>G (p.Pro848=) |
single nucleotide variant |
PIEZO1-related condition [RCV003899023] |
Chr16:88733398 [GRCh38] Chr16:88799806 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.951C>G (p.Gly317=) |
single nucleotide variant |
PIEZO1-related condition [RCV003954881] |
Chr16:88738003 [GRCh38] Chr16:88804411 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3700-5C>A |
single nucleotide variant |
PIEZO1-related condition [RCV003899189] |
Chr16:88726648 [GRCh38] Chr16:88793056 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1670-7C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003894355] |
Chr16:88735060 [GRCh38] Chr16:88801468 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3786C>G (p.Gly1262=) |
single nucleotide variant |
PIEZO1-related condition [RCV003894674] |
Chr16:88726557 [GRCh38] Chr16:88792965 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5298G>T (p.Lys1766Asn) |
single nucleotide variant |
PIEZO1-related condition [RCV003894675] |
Chr16:88721643 [GRCh38] Chr16:88788051 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3785G>A (p.Gly1262Asp) |
single nucleotide variant |
Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema [RCV003989006] |
Chr16:88726558 [GRCh38] Chr16:88792966 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4137C>T (p.Gly1379=) |
single nucleotide variant |
PIEZO1-related condition [RCV003896603] |
Chr16:88725441 [GRCh38] Chr16:88791849 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2967C>T (p.Phe989=) |
single nucleotide variant |
PIEZO1-related condition [RCV003952012] |
Chr16:88732359 [GRCh38] Chr16:88798767 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5400G>T (p.Leu1800=) |
single nucleotide variant |
PIEZO1-related condition [RCV003904388] |
Chr16:88721541 [GRCh38] Chr16:88787949 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1188G>A (p.Arg396=) |
single nucleotide variant |
not provided [RCV003993037] |
Chr16:88737566 [GRCh38] Chr16:88803974 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7071C>T (p.Pro2357=) |
single nucleotide variant |
PIEZO1-related condition [RCV003947294] |
Chr16:88716256 [GRCh38] Chr16:88782664 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3350C>T (p.Ser1117Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003955382] |
Chr16:88727144 [GRCh38] Chr16:88793552 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.539G>A (p.Arg180Gln) |
single nucleotide variant |
PIEZO1-related condition [RCV003977215] |
Chr16:88738663 [GRCh38] Chr16:88805071 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2379C>T (p.Ala793=) |
single nucleotide variant |
not provided [RCV003993086] |
Chr16:88733696 [GRCh38] Chr16:88800104 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7391A>G (p.His2464Arg) |
single nucleotide variant |
PIEZO1-related condition [RCV003907251] |
Chr16:88715780 [GRCh38] Chr16:88782188 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.648C>T (p.Pro216=) |
single nucleotide variant |
PIEZO1-related condition [RCV003956770] |
Chr16:88738427 [GRCh38] Chr16:88804835 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.972C>T (p.Tyr324=) |
single nucleotide variant |
PIEZO1-related condition [RCV003956781] |
Chr16:88737982 [GRCh38] Chr16:88804390 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2181-7C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003949360] |
Chr16:88734061 [GRCh38] Chr16:88800469 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3750C>T (p.Val1250=) |
single nucleotide variant |
PIEZO1-related condition [RCV003949837] |
Chr16:88726593 [GRCh38] Chr16:88793001 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.284-5T>C |
single nucleotide variant |
PIEZO1-related condition [RCV003979128] |
Chr16:88742100 [GRCh38] Chr16:88808508 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5238G>T (p.Leu1746=) |
single nucleotide variant |
PIEZO1-related condition [RCV003957417] |
Chr16:88721703 [GRCh38] Chr16:88788111 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3357G>A (p.Glu1119=) |
single nucleotide variant |
PIEZO1-related condition [RCV003901711] |
Chr16:88727137 [GRCh38] Chr16:88793545 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3936C>T (p.Ala1312=) |
single nucleotide variant |
PIEZO1-related condition [RCV003901955] |
Chr16:88726316 [GRCh38] Chr16:88792724 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4948C>T (p.Leu1650=) |
single nucleotide variant |
PIEZO1-related condition [RCV003896579] |
Chr16:88722225 [GRCh38] Chr16:88788633 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6660+10T>A |
single nucleotide variant |
PIEZO1-related condition [RCV003904626] |
Chr16:88717013 [GRCh38] Chr16:88783421 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1401G>A (p.Ser467=) |
single nucleotide variant |
PIEZO1-related condition [RCV003959628]|not provided [RCV003992818] |
Chr16:88736304 [GRCh38] Chr16:88802712 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2180+3G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003969490] |
Chr16:88734353 [GRCh38] Chr16:88800761 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3735C>T (p.Thr1245=) |
single nucleotide variant |
PIEZO1-related condition [RCV003957023] |
Chr16:88726608 [GRCh38] Chr16:88793016 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3848C>G (p.Ala1283Gly) |
single nucleotide variant |
PIEZO1-related condition [RCV003983340] |
Chr16:88726404 [GRCh38] Chr16:88792812 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.225C>T (p.Leu75=) |
single nucleotide variant |
PIEZO1-related condition [RCV003969619] |
Chr16:88742358 [GRCh38] Chr16:88808766 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.161-4G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003969671] |
Chr16:88742426 [GRCh38] Chr16:88808834 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4955+7dup |
duplication |
PIEZO1-related condition [RCV003944698] |
Chr16:88722210..88722211 [GRCh38] Chr16:88788618..88788619 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3138G>A (p.Ala1046=) |
single nucleotide variant |
PIEZO1-related condition [RCV003902181] |
Chr16:88731764 [GRCh38] Chr16:88798172 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2202C>T (p.Thr734=) |
single nucleotide variant |
PIEZO1-related condition [RCV003961585] |
Chr16:88734033 [GRCh38] Chr16:88800441 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6339G>A (p.Pro2113=) |
single nucleotide variant |
PIEZO1-related condition [RCV003912291] |
Chr16:88719706 [GRCh38] Chr16:88786114 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.141C>T (p.Pro47=) |
single nucleotide variant |
not provided [RCV003887445] |
Chr16:88749403 [GRCh38] Chr16:88815811 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.189G>A (p.Leu63=) |
single nucleotide variant |
PIEZO1-related condition [RCV003893718] |
Chr16:88742394 [GRCh38] Chr16:88808802 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5206T>C (p.Phe1736Leu) |
single nucleotide variant |
not provided [RCV003887416] |
Chr16:88721816 [GRCh38] Chr16:88788224 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3183G>A (p.Pro1061=) |
single nucleotide variant |
PIEZO1-related condition [RCV003949361] |
Chr16:88731719 [GRCh38] Chr16:88798127 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.526C>G (p.Leu176Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003896536] |
Chr16:88738676 [GRCh38] Chr16:88805084 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4055G>T (p.Arg1352Ile) |
single nucleotide variant |
PIEZO1-related condition [RCV003896499] |
Chr16:88725598 [GRCh38] Chr16:88792006 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6660+9G>T |
single nucleotide variant |
PIEZO1-related condition [RCV003896620] |
Chr16:88717014 [GRCh38] Chr16:88783422 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4877C>T (p.Thr1626Ile) |
single nucleotide variant |
not provided [RCV003887697] |
Chr16:88722296 [GRCh38] Chr16:88788704 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2355T>C (p.Ala785=) |
single nucleotide variant |
PIEZO1-related condition [RCV003949753] |
Chr16:88733720 [GRCh38] Chr16:88800128 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2791-4G>A |
single nucleotide variant |
PIEZO1-related condition [RCV003929481] |
Chr16:88732539 [GRCh38] Chr16:88798947 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5488G>T (p.Gly1830Trp) |
single nucleotide variant |
PIEZO1-related condition [RCV003979653] |
Chr16:88721346 [GRCh38] Chr16:88787754 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3672C>A (p.Thr1224=) |
single nucleotide variant |
PIEZO1-related condition [RCV003894202] |
Chr16:88726742 [GRCh38] Chr16:88793150 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6699C>A (p.Ile2233=) |
single nucleotide variant |
PIEZO1-related condition [RCV003894208] |
Chr16:88716860 [GRCh38] Chr16:88783268 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.480G>A (p.Arg160=) |
single nucleotide variant |
PIEZO1-related condition [RCV003913818] |
Chr16:88738722 [GRCh38] Chr16:88805130 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2488-66CCCAAGCCCAGCCCCACGTGCCCACTGCCCTC[4] |
microsatellite |
PIEZO1-related condition [RCV003972007] |
Chr16:88733456..88733457 [GRCh38] Chr16:88799864..88799865 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3987C>T (p.Asn1329=) |
single nucleotide variant |
PIEZO1-related condition [RCV003964503] |
Chr16:88725666 [GRCh38] Chr16:88792074 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3568C>T (p.Leu1190=) |
single nucleotide variant |
PIEZO1-related condition [RCV003944075] |
Chr16:88726846 [GRCh38] Chr16:88793254 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2992-10C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003901847] |
Chr16:88731920 [GRCh38] Chr16:88798328 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3795C>T (p.Asp1265=) |
single nucleotide variant |
PIEZO1-related condition [RCV003901590] |
Chr16:88726548 [GRCh38] Chr16:88792956 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3696G>A (p.Leu1232=) |
single nucleotide variant |
PIEZO1-related condition [RCV003967092] |
Chr16:88726718 [GRCh38] Chr16:88793126 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2111C>T (p.Pro704Leu) |
single nucleotide variant |
PIEZO1-related condition [RCV003922162] |
Chr16:88734425 [GRCh38] Chr16:88800833 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.284-8_284-5del |
deletion |
PIEZO1-related condition [RCV003981313] |
Chr16:88742100..88742103 [GRCh38] Chr16:88808508..88808511 [GRCh37] Chr16:16q24.3 |
likely benign |
GRCh37/hg19 16q24.2-24.3(chr16:87866576-89424113)x1 |
copy number loss |
not provided [RCV003885482] |
Chr16:87866576..89424113 [GRCh37] Chr16:16q24.2-24.3 |
pathogenic |
NM_001142864.4(PIEZO1):c.848+8C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003951586] |
Chr16:88738219 [GRCh38] Chr16:88804627 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2488-66CCCAAGCCCAGCCCCACGTGCCCACTGCCCTC[3] |
microsatellite |
PIEZO1-related condition [RCV003927373] |
Chr16:88733456..88733457 [GRCh38] Chr16:88799864..88799865 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1093C>T (p.Arg365Trp) |
single nucleotide variant |
PIEZO1-related condition [RCV003934140] |
Chr16:88737742 [GRCh38] Chr16:88804150 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1782C>A (p.Ala594=) |
single nucleotide variant |
not provided [RCV003887630] |
Chr16:88734941 [GRCh38] Chr16:88801349 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4341G>A (p.Ala1447=) |
single nucleotide variant |
PIEZO1-related condition [RCV003904457] |
Chr16:88723323 [GRCh38] Chr16:88789731 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2097C>T (p.His699=) |
single nucleotide variant |
PIEZO1-related condition [RCV003904335] |
Chr16:88734439 [GRCh38] Chr16:88800847 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4491G>A (p.Ala1497=) |
single nucleotide variant |
PIEZO1-related condition [RCV003904506] |
Chr16:88723099 [GRCh38] Chr16:88789507 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4851G>A (p.Thr1617=) |
single nucleotide variant |
PIEZO1-related condition [RCV003893994] |
Chr16:88722322 [GRCh38] Chr16:88788730 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.84C>T (p.Ser28=) |
single nucleotide variant |
PIEZO1-related condition [RCV003949777] |
Chr16:88749460 [GRCh38] Chr16:88815868 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.4725C>T (p.Ala1575=) |
single nucleotide variant |
PIEZO1-related condition [RCV003968939] |
Chr16:88722633 [GRCh38] Chr16:88789041 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6789G>C (p.Glu2263Asp) |
single nucleotide variant |
not provided [RCV003884226] |
Chr16:88716696 [GRCh38] Chr16:88783104 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1731C>T (p.Ala577=) |
single nucleotide variant |
PIEZO1-related condition [RCV003954546] |
Chr16:88734992 [GRCh38] Chr16:88801400 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.1908C>T (p.Tyr636=) |
single nucleotide variant |
not provided [RCV003885032] |
Chr16:88734739 [GRCh38] Chr16:88801147 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2648C>A (p.Ser883Tyr) |
single nucleotide variant |
PIEZO1-related condition [RCV003982622] |
Chr16:88733294 [GRCh38] Chr16:88799702 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3411G>A (p.Pro1137=) |
single nucleotide variant |
PIEZO1-related condition [RCV003911894] |
Chr16:88727083 [GRCh38] Chr16:88793491 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5108C>T (p.Ala1703Val) |
single nucleotide variant |
PIEZO1-related condition [RCV003899306] |
Chr16:88721914 [GRCh38] Chr16:88788322 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5030G>A (p.Arg1677Gln) |
single nucleotide variant |
not provided [RCV003884108] |
Chr16:88721992 [GRCh38] Chr16:88788400 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5388C>T (p.His1796=) |
single nucleotide variant |
PIEZO1-related condition [RCV003894400] |
Chr16:88721553 [GRCh38] Chr16:88787961 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6417G>A (p.Val2139=) |
single nucleotide variant |
PIEZO1-related condition [RCV003971864] |
Chr16:88719628 [GRCh38] Chr16:88786036 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5211C>T (p.Thr1737=) |
single nucleotide variant |
PIEZO1-related condition [RCV003921602] |
Chr16:88721811 [GRCh38] Chr16:88788219 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3951C>T (p.Thr1317=) |
single nucleotide variant |
not provided [RCV003884996] |
Chr16:88726301 [GRCh38] Chr16:88792709 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7386C>T (p.Ile2462=) |
single nucleotide variant |
PIEZO1-related condition [RCV003971982] |
Chr16:88715785 [GRCh38] Chr16:88782193 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.6954G>A (p.Glu2318=) |
single nucleotide variant |
PIEZO1-related condition [RCV003901487] |
Chr16:88716456 [GRCh38] Chr16:88782864 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.24G>C (p.Ala8=) |
single nucleotide variant |
PIEZO1-related condition [RCV003902314] |
Chr16:88784941 [GRCh38] Chr16:88851349 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.7239C>G (p.Thr2413=) |
single nucleotide variant |
PIEZO1-related condition [RCV003951539] |
Chr16:88716010 [GRCh38] Chr16:88782418 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3975C>T (p.Phe1325=) |
single nucleotide variant |
PIEZO1-related condition [RCV003946901] |
Chr16:88725678 [GRCh38] Chr16:88792086 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2791-6C>T |
single nucleotide variant |
PIEZO1-related condition [RCV003904554] |
Chr16:88732541 [GRCh38] Chr16:88798949 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2274C>T (p.Ser758=) |
single nucleotide variant |
PIEZO1-related condition [RCV003969000] |
Chr16:88733961 [GRCh38] Chr16:88800369 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5040C>A (p.Tyr1680Ter) |
single nucleotide variant |
Diffuse lymphatic malformation [RCV004018307] |
Chr16:88721982 [GRCh38] Chr16:88788390 [GRCh37] Chr16:16q24.3 |
likely pathogenic |
NM_001142864.4(PIEZO1):c.2233C>G (p.Gln745Glu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503570] |
Chr16:88734002 [GRCh38] Chr16:88800410 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2867A>G (p.His956Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV004503578] |
Chr16:88732459 [GRCh38] Chr16:88798867 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3277G>A (p.Ala1093Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503583] |
Chr16:88727581 [GRCh38] Chr16:88793989 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3449A>G (p.His1150Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV004503586] |
Chr16:88727045 [GRCh38] Chr16:88793453 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4103G>T (p.Arg1368Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503593] |
Chr16:88725475 [GRCh38] Chr16:88791883 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4732C>T (p.Pro1578Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV004503600] |
Chr16:88722626 [GRCh38] Chr16:88789034 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5135T>G (p.Val1712Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV004503602] |
Chr16:88721887 [GRCh38] Chr16:88788295 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.536C>T (p.Thr179Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV004503605] |
Chr16:88738666 [GRCh38] Chr16:88805074 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5617T>C (p.Phe1873Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503609] |
Chr16:88721217 [GRCh38] Chr16:88787625 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5777G>T (p.Arg1926Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503616] |
Chr16:88720640 [GRCh38] Chr16:88787048 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5890A>G (p.Met1964Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004503619] |
Chr16:88720444 [GRCh38] Chr16:88786852 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6071G>A (p.Arg2024His) |
single nucleotide variant |
Inborn genetic diseases [RCV004503622] |
Chr16:88720162 [GRCh38] Chr16:88786570 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6112G>C (p.Val2038Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503623] |
Chr16:88720121 [GRCh38] Chr16:88786529 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.620T>C (p.Leu207Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV004503625] |
Chr16:88738582 [GRCh38] Chr16:88804990 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6251G>A (p.Gly2084Asp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503626] |
Chr16:88719874 [GRCh38] Chr16:88786282 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6484C>A (p.Pro2162Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503627] |
Chr16:88717199 [GRCh38] Chr16:88783607 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6895A>G (p.Ile2299Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004503628] |
Chr16:88716590 [GRCh38] Chr16:88782998 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7370G>C (p.Gly2457Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV004503633] |
Chr16:88715801 [GRCh38] Chr16:88782209 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.949G>A (p.Gly317Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV004503636] |
Chr16:88738005 [GRCh38] Chr16:88804413 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.107T>A (p.Leu36His) |
single nucleotide variant |
Inborn genetic diseases [RCV004503555] |
Chr16:88749437 [GRCh38] Chr16:88815845 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1108C>G (p.His370Asp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503557] |
Chr16:88737646 [GRCh38] Chr16:88804054 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1420G>A (p.Gly474Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV004503560] |
Chr16:88736285 [GRCh38] Chr16:88802693 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2134G>A (p.Glu712Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503568] |
Chr16:88734402 [GRCh38] Chr16:88800810 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2843G>A (p.Arg948His) |
single nucleotide variant |
Inborn genetic diseases [RCV004503577] |
Chr16:88732483 [GRCh38] Chr16:88798891 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2947C>T (p.Leu983Phe) |
single nucleotide variant |
Inborn genetic diseases [RCV004503580] |
Chr16:88732379 [GRCh38] Chr16:88798787 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4616T>C (p.Met1539Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503598] |
Chr16:88722889 [GRCh38] Chr16:88789297 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5168C>T (p.Pro1723Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503603] |
Chr16:88721854 [GRCh38] Chr16:88788262 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5692G>C (p.Glu1898Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV004503613] |
Chr16:88720725 [GRCh38] Chr16:88787133 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5957C>T (p.Ser1986Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503620] |
Chr16:88720276 [GRCh38] Chr16:88786684 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7393T>C (p.Ser2465Pro) |
single nucleotide variant |
Inborn genetic diseases [RCV004503634] |
Chr16:88715778 [GRCh38] Chr16:88782186 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1574C>T (p.Thr525Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV004503563] |
Chr16:88735230 [GRCh38] Chr16:88801638 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2195G>A (p.Ser732Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV004503569] |
Chr16:88734040 [GRCh38] Chr16:88800448 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3977C>T (p.Ala1326Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004503591] |
Chr16:88725676 [GRCh38] Chr16:88792084 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4358C>A (p.Thr1453Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV004503595] |
Chr16:88723306 [GRCh38] Chr16:88789714 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4474G>A (p.Gly1492Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV004503597] |
Chr16:88723116 [GRCh38] Chr16:88789524 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5086A>C (p.Ile1696Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503601] |
Chr16:88721936 [GRCh38] Chr16:88788344 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5281C>T (p.Arg1761Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503604] |
Chr16:88721660 [GRCh38] Chr16:88788068 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7088C>G (p.Pro2363Arg) |
single nucleotide variant |
Inborn genetic diseases [RCV004503630] |
Chr16:88716239 [GRCh38] Chr16:88782647 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1102G>C (p.Asp368His) |
single nucleotide variant |
Inborn genetic diseases [RCV004503556] |
Chr16:88737733 [GRCh38] Chr16:88804141 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1153G>A (p.Val385Met) |
single nucleotide variant |
Inborn genetic diseases [RCV004503558] |
Chr16:88737601 [GRCh38] Chr16:88804009 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1441C>T (p.Arg481Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503561] |
Chr16:88736264 [GRCh38] Chr16:88802672 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1624G>A (p.Ala542Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503564] |
Chr16:88735180 [GRCh38] Chr16:88801588 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.1868G>A (p.Arg623Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV004503566] |
Chr16:88734779 [GRCh38] Chr16:88801187 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2284G>T (p.Gly762Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503571] |
Chr16:88733951 [GRCh38] Chr16:88800359 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2293G>A (p.Val765Met) |
single nucleotide variant |
Inborn genetic diseases [RCV004503572] |
Chr16:88733942 [GRCh38] Chr16:88800350 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.2419C>T (p.Arg807Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503573] |
Chr16:88733656 [GRCh38] Chr16:88800064 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2557A>T (p.Met853Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503574] |
Chr16:88733385 [GRCh38] Chr16:88799793 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2641G>C (p.Glu881Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV004503575] |
Chr16:88733301 [GRCh38] Chr16:88799709 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.2824G>A (p.Glu942Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503576] |
Chr16:88732502 [GRCh38] Chr16:88798910 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3223G>A (p.Val1075Ile) |
single nucleotide variant |
Inborn genetic diseases [RCV004503581] |
Chr16:88727635 [GRCh38] Chr16:88794043 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.3272T>G (p.Phe1091Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503582] |
Chr16:88727586 [GRCh38] Chr16:88793994 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.327G>C (p.Arg109Ser) |
single nucleotide variant |
Inborn genetic diseases [RCV004503584] |
Chr16:88741616 [GRCh38] Chr16:88808024 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3331C>A (p.Gln1111Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503585] |
Chr16:88727163 [GRCh38] Chr16:88793571 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3463C>G (p.Leu1155Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004503587] |
Chr16:88726951 [GRCh38] Chr16:88793359 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3541C>T (p.Arg1181Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503588] |
Chr16:88726873 [GRCh38] Chr16:88793281 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.358C>T (p.Arg120Trp) |
single nucleotide variant |
Inborn genetic diseases [RCV004503589] |
Chr16:88741585 [GRCh38] Chr16:88807993 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.3814A>G (p.Arg1272Gly) |
single nucleotide variant |
Inborn genetic diseases [RCV004503590] |
Chr16:88726438 [GRCh38] Chr16:88792846 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4214C>T (p.Pro1405Leu) |
single nucleotide variant |
Inborn genetic diseases [RCV004503594] |
Chr16:88725029 [GRCh38] Chr16:88791437 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.4639C>T (p.Arg1547Cys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503599] |
Chr16:88722866 [GRCh38] Chr16:88789274 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5560A>G (p.Thr1854Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV004503606] |
Chr16:88721274 [GRCh38] Chr16:88787682 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5600G>C (p.Arg1867Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503607] |
Chr16:88721234 [GRCh38] Chr16:88787642 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5627G>T (p.Arg1876Met) |
single nucleotide variant |
Inborn genetic diseases [RCV004503610] |
Chr16:88721207 [GRCh38] Chr16:88787615 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5648G>A (p.Arg1883Gln) |
single nucleotide variant |
Inborn genetic diseases [RCV004503611] |
Chr16:88721186 [GRCh38] Chr16:88787594 [GRCh37] Chr16:16q24.3 |
likely benign |
NM_001142864.4(PIEZO1):c.5692G>A (p.Glu1898Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503612] |
Chr16:88720725 [GRCh38] Chr16:88787133 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5737C>G (p.Pro1913Ala) |
single nucleotide variant |
Inborn genetic diseases [RCV004503615] |
Chr16:88720680 [GRCh38] Chr16:88787088 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5859G>C (p.Lys1953Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV004503618] |
Chr16:88720475 [GRCh38] Chr16:88786883 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.5962G>A (p.Ala1988Thr) |
single nucleotide variant |
Inborn genetic diseases [RCV004503621] |
Chr16:88720271 [GRCh38] Chr16:88786679 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.6993C>G (p.Asn2331Lys) |
single nucleotide variant |
Inborn genetic diseases [RCV004503629] |
Chr16:88716417 [GRCh38] Chr16:88782825 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.719T>A (p.Ile240Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV004503631] |
Chr16:88738356 [GRCh38] Chr16:88804764 [GRCh37] Chr16:16q24.3 |
uncertain significance |
NM_001142864.4(PIEZO1):c.7318A>G (p.Ile2440Val) |
single nucleotide variant |
Inborn genetic diseases [RCV004503632] |
Chr16:88715853 [GRCh38] Chr16:88782261 [GRCh37] Chr16:16q24.3 |
uncertain significance |