| Gene: Mir9-2 (microRNA 9-2) Rattus norvegicus |
|
 Analyze |
|
| Symbol: |
Mir9-2 |
| Name: |
microRNA 9-2 |
| RGD ID: |
2325602 |
| Description: |
Predicted to be involved in miRNA-mediated post-transcriptional gene silencing. Predicted to be part of RISC complex. |
| Type: |
ncrna
|
| RefSeq Status: |
PROVISIONAL |
| Previously known as: |
Mir9a-2; rno-mir-9-2; rno-mir-9a-2 |
| Latest Assembly: |
GRCr8 - GRCr8 Assembly |
| Position: |
| Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
|---|
| JBrowse | NCBI | UCSC | Ensembl |
|---|
GRCr8 | 2 | 15,933,292 - 15,933,378 (+) | NCBI | GRCr8 | GRCr8 | | GRCr8 | mRatBN7.2 | 2 | 14,197,724 - 14,197,810 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | UTH_Rnor_SHR_Utx | 2 | 21,259,062 - 21,259,148 (+) | NCBI | UTH_Rnor_SHR_Utx | UTH_Rnor_SHR_Utx | | | UTH_Rnor_SHRSP_BbbUtx_1.0 | 2 | 19,359,283 - 19,359,369 (+) | NCBI | UTH_Rnor_SHRSP_BbbUtx_1.0 | UTH_Rnor_SHRSP_BbbUtx_1.0 | | | UTH_Rnor_WKY_Bbb_1.0 | 2 | 14,032,877 - 14,032,963 (+) | NCBI | UTH_Rnor_WKY_Bbb_1.0 | UTH_Rnor_WKY_Bbb_1.0 | | | Rnor_6.0 | 2 | 11,884,671 - 11,884,757 (+) | NCBI | Rnor_6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_5.0 | 2 | 11,746,822 - 11,746,908 (+) | NCBI | Rnor_5.0 | Rnor_5.0 | rn5 | | Celera | 2 | 10,511,363 - 10,511,449 (+) | NCBI | | Celera | | | Cytogenetic Map | 2 | q11 | NCBI | | | | |
|
| JBrowse: |
|
References
Additional References at PubMed
Genomics
QTLs in Region (GRCr8)
| 1578664 | Bmd9 | Bone mineral QTL density 9 | 5 | | femur mineral mass (VT:0010011) | total volumetric bone mineral density (CMO:0001728) | 2 | 5736325 | 50736325 | Rat | | 1331764 | Bp205 | Blood pressure QTL 205 | 3.476 | | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 2 | 14368707 | 59368707 | Rat | | 738010 | Lnnr3 | Liver neoplastic nodule remodeling QTL 3 | 2.94 | | liver integrity trait (VT:0010547) | liver remodeling tumorous lesion number (CMO:0001461) | 2 | 1 | 42977529 | Rat | | 9590080 | Insglur4 | Insulin/glucose ratio QTL 4 | 28.7 | 0.001 | blood insulin amount (VT:0001560) | calculated plasma insulin level (CMO:0002170) | 2 | 6152767 | 51152767 | Rat | | 10755430 | Coatc6 | Coat color QTL 6 | | 0.02576 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 2 | 13325041 | 58325041 | Rat | | 1600379 | Mcs18 | Mammary carcinoma susceptibility QTL 18 | 2.6 | | mammary gland integrity trait (VT:0010552) | mammary tumor number (CMO:0000343) | 2 | 9623581 | 44538110 | Rat | | 1331760 | Bp206 | Blood pressure QTL 206 | 3.62454 | | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 2 | 4265106 | 205135428 | Rat | | 731166 | Mamtr2 | Mammary tumor resistance QTL 2 | | 0.0001 | mammary gland integrity trait (VT:0010552) | mammary tumor number (CMO:0000343) | 2 | 9623581 | 54623581 | Rat | | 61368 | Mcs1 | Mammary carcinoma susceptibility QTL 1 | 4.4 | | mammary gland integrity trait (VT:0010552) | mammary tumor number (CMO:0000343) | 2 | 9623581 | 25054526 | Rat | | 61355 | Bp36 | Blood pressure QTL 36 | 2.9 | | blood pressure trait (VT:0000183) | systolic blood pressure (CMO:0000004) | 2 | 7605533 | 104774005 | Rat | |
Expression
RNA-SEQ Expression
Sequence
| RefSeq Acc Id: |
NR_031813 |
| RefSeq Status: |
PROVISIONAL |
| Type: |
NON-CODING |
| Position: |
| Rat Assembly | Chr | Position (strand) | Source |
|---|
GRCr8 | 2 | 15,933,292 - 15,933,378 (+) | NCBI | mRatBN7.2 | 2 | 14,197,724 - 14,197,810 (+) | NCBI | Rnor_6.0 | 2 | 11,884,671 - 11,884,757 (+) | NCBI | Rnor_5.0 | 2 | 11,746,822 - 11,746,908 (+) | NCBI | Celera | 2 | 10,511,363 - 10,511,449 (+) | NCBI |
|
| Sequence: |
GGAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCATAAAGCTAGAT AACCGAAAGTAAAAACTCCTTCA
hide sequence
|
Additional Information
Nomenclature History
| Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
| 2015-04-09 |
Mir9-2 |
microRNA 9-2 |
Mir9-2 |
microRNA mir-9-2 |
Name updated |
61478 |
APPROVED |
| 2010-06-02 |
Mir9-2 |
microRNA mir-9-2 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|