Advanced Search (OLGA)

Gene: MIR99A-2 (microRNA mir-99a-2) Canis lupus familiaris

Analyze

Symbol:

MIR99A-2 (Ensembl: MIR100)

Name:

microRNA mir-99a-2

RGD ID:

12431114

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

cfa-mir-99a-2; microRNA 99a-2

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	12,047,369 - 12,047,425 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	12,047,369 - 12,047,425 (+)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	12,102,421 - 12,102,477 (+)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	11,996,862 - 11,996,918 (+)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	11,996,862 - 11,996,918 (+)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	12,100,869 - 12,100,925 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	12,040,078 - 12,040,134 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	12,078,962 - 12,079,018 (+)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Alzheimer's disease (ISO)

Animal Mammary Neoplasms (ISO)

Chemical and Drug Induced Liver Injury (ISO)

Disease Progression (ISO)

glomerulonephritis (ISO)

hepatitis B (ISO)

Neoplasm Metastasis (ISO)

pancreatitis (ISO)

transitional cell carcinoma (ISO)

urinary bladder cancer (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular hyperosmotic salinity response (ISO)

cellular response to leukemia inhibitory factor (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (IEA,ISO)

myelination (ISO)

negative regulation of BMP signaling pathway (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-8 production (ISO)

negative regulation of osteoblast differentiation (ISO)

negative regulation of vascular associated smooth muscle cell differentiation (ISO)

positive regulation of stem cell differentiation (ISO)

sensory perception of sound (ISO)

Cellular Component

RISC complex (IEA)

synapse (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing post-transcriptional repressor activity (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:18392026

Genomics

Comparative Map Data

MIR99A-2
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	12,047,369 - 12,047,425 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	12,047,369 - 12,047,425 (+)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	12,102,421 - 12,102,477 (+)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	11,996,862 - 11,996,918 (+)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	11,996,862 - 11,996,918 (+)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	12,100,869 - 12,100,925 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	12,040,078 - 12,040,134 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	12,078,962 - 12,079,018 (+)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

MIR100
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	11	122,152,229 - 122,152,308 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	11	122,152,229 - 122,152,308 (-)	Ensembl			hg38	GRCh38
GRCh37	11	122,022,937 - 122,023,016 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	11	121,528,146 - 121,528,225 (-)	NCBI	Build 36	Build 36	hg18	NCBI36
Celera	11	119,183,604 - 119,183,683 (-)	NCBI		Celera
Cytogenetic Map	11	q24.1	NCBI
HuRef	11	117,969,463 - 117,969,542 (-)	NCBI		HuRef
CHM1_1	11	121,910,234 - 121,910,313 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	11	122,181,220 - 122,181,299 (-)	NCBI		T2T-CHM13v2.0

Mir100
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	41,442,721 - 41,442,800 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	9	41,442,721 - 41,442,800 (+)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	9	41,531,425 - 41,531,504 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	41,531,425 - 41,531,504 (+)	Ensembl			mm10	GRCm38
MGSCv37	9	41,339,508 - 41,339,587 (+)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
Celera	9	38,770,225 - 38,770,304 (+)	NCBI		Celera
Cytogenetic Map	9	A5.1	NCBI
cM Map	9	23.41	NCBI

Mir100
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	8	50,798,295 - 50,798,374 (+)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	8	50,798,295 - 50,798,374 (+)	Ensembl				GRCr8
mRatBN7.2	8	41,901,225 - 41,901,304 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	8	41,901,225 - 41,901,304 (+)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	8	47,393,696 - 47,393,775 (+)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	8	45,672,341 - 45,672,420 (+)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	8	43,539,916 - 43,539,995 (+)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	8	45,746,948 - 45,747,027 (+)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	45,746,948 - 45,747,027 (+)	Ensembl			rn6	Rnor6.0
Rnor_5.0	8	44,222,150 - 44,222,229 (+)	NCBI	Rnor_5.0	Rnor_5.0	rn5
Celera	8	41,500,067 - 41,500,146 (+)	NCBI		Celera
Cytogenetic Map	8	q22	NCBI

MIR100
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	9	49,157,909 - 49,157,988 (-)	Ensembl			susScr11	Sscrofa11.1
Sscrofa11.1	9	49,157,909 - 49,157,988 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	9	54,383,382 - 54,383,461 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

alimentary part of gastrointestinal system	circulatory system	ectoderm	endocrine system	hemolymphoid system	mesenchyme	mesoderm
1	2	1	1	1	6	5

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_049329	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000059	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000089	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000371	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSCAFT00000032586

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1 Ensembl	5	12,047,369 - 12,047,425 (+)	Ensembl

Ensembl Acc Id:

ENSCAFT00845023705

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
ROS_Cfam_1.0 Ensembl	5	11,996,862 - 11,996,918 (+)	Ensembl

RefSeq Acc Id:

NR_049329

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	5	12,047,369 - 12,047,425 (+)	NCBI
Dog10K_Boxer_Tasha	5	12,102,421 - 12,102,477 (+)	NCBI
ROS_Cfam_1.0	5	11,996,862 - 11,996,918 (+)	NCBI
UMICH_Zoey_3.1	5	12,100,869 - 12,100,925 (+)	NCBI
UNSW_CanFamBas_1.0	5	12,040,078 - 12,040,134 (+)	NCBI
UU_Cfam_GSD_1.0	5	12,078,962 - 12,079,018 (+)	NCBI

Sequence:

show sequence

AACCCGTAGATCCGATCTTGTGGTGATAGTCCACACAAGCTTGTGTCTATAGGTATG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSCAFG00000020479	Ensembl
	ENSCAFG00845013309	Ensembl, ENTREZGENE
Ensembl Transcript	ENSCAFT00845023705	ENTREZGENE
miRBase	MI0008102	ENTREZGENE
NCBI Gene	MIR99A-2	ENTREZGENE
RNAcentral	URS0000502116	RNACentral
	URS00007E3D3B	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-04-02	MIR99A-2	microRNA mir-99a-2		microRNA 99a-2	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD