Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Nfe2l2em1Mcwi

Symbol: SD-Nfe2l2em1Mcwi
Strain: SD-Nfe2l2em1
Substrain: Mcwi
RGD ID: 9588552
RRID: RGD_9588552
Ontology ID: RS:0003831
Alleles: Nfe2l2em1Mcwi
Also known as: SD-Nfe2l2em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.
Last Known Status: Live Animals (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2360,594,239 - 60,621,785RGD_MAPPER_PIPELINE
Rnor_6.0362,497,568 - 62,525,146RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0369,041,641 - 69,069,190RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4358,366,693 - 58,394,116RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Nfe2l2em1Mcwi-var1 chr3 62524893 62524933 TGTAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAG - deletion

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2015-04-24 SD-Nfe2l2em1Mcwi    SD-Nfe2l2em1Mcwi    Name updated 68913 APPROVED
2015-04-24 SD-Nfe2l2em1Mcwi    SD-Nfe2l2em1Mcwi    Name updated 68913 APPROVED