Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Atp2b1em2Mcwi

Symbol: SS-Atp2b1em2Mcwi
Strain: SS-Atp2b1em2
Substrain: Mcwi
RGD ID: 6484711
Citation ID: RRID:RGD_6484711
Ontology ID: RS:0003280
Alleles: Atp2b1em2Mcwi
Also Known As: SS-Atp2b1em2Mcwi; SS-Atp2b1^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence TACCTTCTGGGTTCAgaagagGCCGTGGCTTGCTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 117-bp deletion in intron 8 and exon 9.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2733,735,595 - 33,845,226RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0741,196,115 - 41,196,231RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0741,153,926 - 41,262,537RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4736,493,661 - 36,600,280RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Atp2b1em2Mcwi-var1 chr7 41196115 41196231 CATTTCCTGCCTTTGTAGGTCTGCTGATGTCTGCCATCACGGTTATCATCCTAGTGCTATATTTTGTGATCGATACCTTCTGGGTTCAGAAGAGGCCGTGGCTTGCTGAGTGCACGC - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Atp2b1em2Mcwi    SS-Atp2b1em2Mcwi    Name updated 68913 APPROVED