Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: F344.AR-Ednrbsl/Hkv

Symbol: F344.AR-Ednrbsl/Hkv
Strain: F344-Ednrbsl
Substrain: Hkv
Full Name: Aganglionosis rat
RGD ID: 6480223
Citation ID: RRID:RGD_6480223
Ontology ID: RS:0003210
Alleles: Ednrbsl
Also known as: F344-Ednrbsl; F344-Ednrbsl; F344-EdnrbslHkv; F344.AR-Ednrbsl/Hkv; NBRP Rat No: 0801
Type: mutant
Source: Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan, National BioResource Project for the Rat in Japan
Origin: This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc.
Inbred Generations: N10
Last Known Status: Cryopreserved Embryo (as of 2016-10-28)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21580,640,839 - 80,672,115RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01588,004,775 - 88,036,354RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01591,500,400 - 91,531,979RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41587,893,141 - 87,898,700RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References


Region

Strain QTL Data
Symbol Name Trait
Gdil1 Gastrointestinal dilation QTL 1 enteric ganglion morphology trait   (VT:0001045)    
Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics Homozygous rats shows auditory disorder (congenital deafness). 40% of homozygous rats dies of megacolon and this mortality is lower than that of AGH rats (100%). Heterozygous (sl/+) rats don't show any phenotypes. 1302502
strain_reproduction all pups survived to weaning, almost 60% pups had no symptoms of aganglionosis 6480215
strain_reproduction maintained in heterozygous condition: A part of homozygous rats dies of megacolon. 1302502

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-10-31 F344.AR-Ednrbsl/Hkv  Aganglionosis rat  F344.AR-EdnrbslHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-10-31 F344.AR-EdnrbslHkv  Aganglionosis rat  F344.AR-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-10-28 F344.AR-EdnrbSlHkv  Aganglionosis rat  F344-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED