Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: LE/Hkv.AR-Ednrbsl

Symbol: LE/Hkv.AR-Ednrbsl
Strain: LE.AR-Ednrbsl
Substrain: Hkv
Full Name: Aganglionosis rat
RGD ID: 6480220
RRID: RGD_6480220
Ontology ID: RS:0003209
Alleles: Ednrbsl
Also known as: LEH/Hkv-Ednrbsl; LEH/Hkv-Ednrbsl; LEH.AR-Ednrbsl/Hkv; NBRP Rat No: 0802; LEH.AR-Ednrbsl/Hkv; LE/Hkv.AR-Ednrbsl
Type: mutant
Source: Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan, National BioResource Project for the Rat in Japan
Origin: This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrbsl was introduced into Long-Evans by Dr. Ozaki (NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm), and this rat was provided to Dr. Agui at Hokkaido University and inbred line was established by sib mating.
Inbred Generations: F21
Last Known Status: Cryopreserved Embryo (as of 2016-11-15)
Research Usage Internal Medicine
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21580,640,839 - 80,672,115RGD_MAPPER_PIPELINE
Rnor_6.01588,004,775 - 88,036,354RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01591,500,400 - 91,531,979RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41587,893,141 - 87,898,700RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References


Region

Strain QTL Data
Symbol Name Trait
Coatc10 Coat color QTL 10 coat/hair pigmentation trait   (VT:0010463)    
Coatc11 Coat color QTL 11 coat/hair pigmentation trait   (VT:0010463)    
Coatc12 Coat color QTL 12 coat/hair pigmentation trait   (VT:0010463)    
Coatc13 Coat color QTL 13 coat/hair pigmentation trait   (VT:0010463)    
Coatc14 Coat color QTL 14 coat/hair pigmentation trait   (VT:0010463)    
Coatc15 Coat color QTL 15 coat/hair pigmentation trait   (VT:0010463)    
Coatc16 Coat color QTL 16 coat/hair pigmentation trait   (VT:0010463)    
Coatc6 Coat color QTL 6 coat/hair pigmentation trait   (VT:0010463)    
Coatc7 Coat color QTL 7 coat/hair pigmentation trait   (VT:0010463)    
Coatc8 Coat color QTL 8 coat/hair pigmentation trait   (VT:0010463)    
Coatc9 Coat color QTL 9 coat/hair pigmentation trait   (VT:0010463)    
Gdil2 Gastrointestinal dilation QTL 2 enteric ganglion morphology trait   (VT:0001045)    
Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_anatomy abnormal dilation of the intestines due to absence of ganglion cells is observed in 14 days postnatal rats (shorter as compared to AR-EdnrbSlHkv 10402048
strain_characteristics Homozygous rats show auditory disorder (congenital deafness) and die of megacolon. This strain can survive longer than AGH rat and shows milder phenotype. Heterozygous (sl/+) rats don't show any phenotypes. 1302502
strain_reproduction maintained in heterozygous condition 1302502

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-05-01 LE/Hkv.AR-Ednrbsl  Aganglionosis rat  LEH/Hkv.AR-Ednrbsl  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-11-15 LEH/Hkv.AR-Ednrbsl  Aganglionosis rat  LEH/Hkv.AR-Ednrbsl  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-11-15 LEH/Hkv.AR-Ednrbsl  Aganglionosis rat  LEH.AR-EdnrbslHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-04-22 LEH.AR-EdnrbslHkv  Aganglionosis rat  LE.AR-EdnrbslHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-04-22 LE.AR-EdnrbslHkv  Aganglionosis rat  LE-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2012-03-16 LE-EdnrbSlHkv  Aganglionosis rat  LE-EdnrbSlHkv  Aganglionosis rat  Name updated 68913 APPROVED