Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Sh2b3em2Mcwi

Symbol: SS-Sh2b3em2Mcwi
Strain: SS-Sh2b3em2
Substrain: Mcwi
RGD ID: 5509994
Citation ID: RRID:RGD_5509994
Ontology ID: RS:0003012
Alleles: Sh2b3em2Mcwi
Also Known As: SS-Sh2b3em2Mcwi; SS-Sh2b3^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
Last Known Status: Cryopreserved Sperm (as of 2021-11-03)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21234,750,773 - 34,750,773RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01240,261,990 - 40,265,757RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01242,132,947 - 42,136,714RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41235,954,679 - 35,958,446RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains
SS-Sh2b3em2Mcwi-/-





References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Sh2b3em2Mcwi-var1 chr12 34750773 34750773 A - deletion mRatBN7.2

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_other According to personal communication between RGD curators and Dr. H. Jacob's group the position of the 1-bp deletion is in exon 7 in SS/JrHsdMcwi (JX215366) 4139871
strain_other 1-bp deletion (848) in exon 2 in the reference sequence differs from JX215366 4139871

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-11-10 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-11-10 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-11-10 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-11-10 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Symbol updated 68687 APPROVED
2013-03-21 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED
2013-03-21 SS-Sh2b3em2Mcwi    SS-Sh2b3em2Mcwi    Name updated 68913 APPROVED