This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
According to personal communication between RGD curators and Dr. H. Jacob's group the position of the 1-bp deletion is in exon 7 in SS/JrHsdMcwi (JX215366)