Strain Report - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: SS-Nox4em1Mcwi

Symbol: SS-Nox4em1Mcwi
Strain: SS-Nox4em1
Substrain: Mcwi
RGD ID: 5131963
Citation ID: RRID:RGD_5131963
Ontology ID: RS:0002592
Alleles: Nox4em1Mcwi
Previously known as: SS-Nox4em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21140,900,886 - 141,078,844RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01150,861,998 - 150,862,002RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01157,106,652 - 157,285,107RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41143,415,816 - 143,603,554RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nox4em1Mcwi-var1 chr1 150861998 150862002 CTATG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Symbol updated 68687 APPROVED
2013-08-13 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED