Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Sh2b3em1Mcwi

Symbol: SS-Sh2b3em1Mcwi
Strain: SS-Sh2b3em1
Substrain: Mcwi
RGD ID: 4139885
RRID: RGD_4139885
Ontology ID: RS:0002439
Alleles: Sh2b3em1Mcwi
Also known as: SS-Sh2b3em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21234,749,849 - 34,753,616RGD_MAPPER_PIPELINE
Rnor_6.01240,261,990 - 40,265,757RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01242,132,947 - 42,136,714RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41235,954,679 - 35,958,446RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Sh2b3em1Mcwi-var1 chr12 40262913 40262918 CACTTG - deletion

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Sh2b3em1Mcwi    SS-Sh2b3em1Mcwi    Name updated 68913 APPROVED