Strain: SS-Sh2b3em1Mcwi

Symbol: SS-Sh2b3em1Mcwi
Strain: SS-Sh2b3em1
Substrain: Mcwi
Ontology ID: RS:0002439
Alleles: Sh2b3em1Mcwi
Also known as: SS-Sh2b3em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01240,261,990 - 40,265,757RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01242,132,947 - 42,136,714RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41235,954,679 - 35,958,446RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains

Experimental Data Annotations
References - curated

Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139885
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE