Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Rag1em1Mcwi

Symbol: SS-Rag1em1Mcwi
Strain: SS-Rag1em1
Substrain: Mcwi
RGD ID: 4139884
Citation ID: RRID:RGD_4139884
Ontology ID: RS:0002438
Alleles: Rag1em1Mcwi
Previously known as: SS-Rag1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.
Last Known Status: Cryopreserved Sperm (as of 2021-11-03)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2387,917,061 - 87,928,158RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0391,206,394 - 91,217,491RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0397,866,048 - 97,877,145RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4386,780,782 - 86,791,878RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. GENETIC MUTATION OF RECOMBINATION ACTIVATING GENE 1 IN DAHL SALT-SENSITIVE RATS ATTENUATES HYPERTENSION AND RENAL DAMAGE. Mattson DL, etal., Am J Physiol Regul Integr Comp Physiol. 2013 Jan 30.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Rag1em1Mcwi-var1 chr3 87922904 87922916 GTCACATTCCTTG - deletion
Rag1em1Mcwi-var1 chr3 91212237 91212249 GTCACATTCCTTG - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_other depletion of mature T- and B-cells is observed 7207429

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2013-03-21 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2013-03-21 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED