Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Rag1em1Mcwi

Symbol: SS-Rag1em1Mcwi
Strain: SS-Rag1em1
Substrain: Mcwi
RGD ID: 4139884
RRID: RGD_4139884
Ontology ID: RS:0002438
Alleles: Rag1em1Mcwi
Also known as: SS-Rag1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2387,917,061 - 87,928,158RGD_MAPPER_PIPELINE
Rnor_6.0391,206,394 - 91,217,491RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0397,866,048 - 97,877,145RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4386,780,782 - 86,791,878RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References


Region

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Rag1em1Mcwi-var1 chr3 91212237 91212249 GTCACATTCCTTG - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_other depletion of mature T- and B-cells is observed 7207429

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2013-03-21 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED
2013-03-21 SS-Rag1em1Mcwi    SS-Rag1em1Mcwi    Name updated 68913 APPROVED