Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Nox4em2Mcwi

Symbol: SS-Nox4em2Mcwi
Strain: SS-Nox4em2
Substrain: Mcwi
RGD ID: 4139883
RRID: RGD_4139883
Ontology ID: RS:0002437
Alleles: Nox4em2Mcwi
Also known as: SS-Nox4em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21140,900,886 - 141,078,844RGD_MAPPER_PIPELINE
Rnor_6.01150,796,359 - 150,976,186RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01157,106,652 - 157,285,107RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41143,415,816 - 143,603,554RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Name updated 68913 APPROVED