Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Nppaem4Mcwi

Symbol: SS-Nppaem4Mcwi
Strain: SS-Nppaem4
Substrain: Mcwi
RGD ID: 4139882
Citation ID: RRID:RGD_4139882
Ontology ID: RS:0002436
Alleles: Nppaem4Mcwi
Also Known As: SS-Nppaem4Mcwi; SS-Nppa^[em4Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.
Last Known Status: Cryopreserved Sperm (as of 2021-11-03)
Genotyping Protocol Download Genotyping Protocol
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25158,429,042 - 158,430,351RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.05164,808,762 - 164,808,783RGD_MAPPER_PIPELINERnor6.0
Rnor_5.05168,466,309 - 168,467,618RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.45165,074,518 - 165,075,827RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Identifying multiple causative genes at a single GWAS locus. Flister MJ, etal., Genome Res. 2013 Dec;23(12):1996-2002. doi: 10.1101/gr.160283.113. Epub 2013 Sep 4.
2. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nppaem4Mcwi-var1 chr5 164808762 164808783 CGCAGGCCCTGAGCGAGCAGAC - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Nppaem4Mcwi    SS-Nppaem4Mcwi    Name updated 68913 APPROVED