Strain: SS-Renem1Mcwi

Symbol: SS-Renem1Mcwi
Strain: SS-Renem1
Substrain: Mcwi
Ontology ID: RS:0002434
Alleles: Renem1Mcwi
Also known as: SS-Renem1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01350,502,724 - 50,513,953RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01355,555,583 - 55,566,812RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41346,262,936 - 46,275,213RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains

Experimental Data Annotations
References - curated

Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139880
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE