Strain Report - Rat Genome Database

Send us a Message

Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Nckap5em1Mcwi

Symbol: SS-Nckap5em1Mcwi
Strain: SS-Nckap5em1
Substrain: Mcwi
RGD ID: 4139879
RRID: RGD_4139879
Ontology ID: RS:0002433
Alleles: Nckap5em1Mcwi
Also known as: SS-Nap5em1Mcwi; SS-Nap5em1Mcwi; SS-Nckap5em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.
Last Known Status: Extinct
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21337,369,948 - 38,283,257RGD_MAPPER_PIPELINE
Rnor_6.01342,265,875 - 43,049,232RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01347,369,687 - 48,273,649RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41338,444,115 - 39,275,959RGD_MAPPER_PIPELINERGSC3.4


References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines


Additional Information

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Nckap5em1Mcwi    SS-Nckap5em1Mcwi    Name updated 68913 APPROVED
2012-08-24 SS-Nckap5em1Mcwi    SS-Nap5em1Mcwi    Symbol updated 68687 APPROVED
2012-08-24 SS-Nckap5em1Mcwi    SS-Nap5em1Mcwi    Name updated 68913 APPROVED
2012-08-24 SS-Nckap5em1Mcwi    SS-Nap5em1Mcwi    Symbol updated 68687 APPROVED
2012-08-24 SS-Nckap5em1Mcwi    SS-Nap5em1Mcwi    Name updated 68913 APPROVED