Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Mmp2em2Mcwi

Symbol: SS-Mmp2em2Mcwi
Strain: SS-Mmp2em2
Substrain: Mcwi
RGD ID: 4139878
RRID: RGD_4139878
Ontology ID: RS:0002432
Alleles: Mmp2em2Mcwi
Also known as: SS-Mmp2em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.
Last Known Status: Unknown (as of 2017-07-18)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21914,154,657 - 14,182,870RGD_MAPPER_PIPELINE
Rnor_6.01915,542,771 - 15,570,589RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01926,629,728 - 26,658,966RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41915,246,036 - 15,275,061RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED