Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: FHH-Chr 1BN-Sorcs1em1Mcwi

Symbol: FHH-Chr 1BN-Sorcs1em1Mcwi
Strain: FHH-Chr 1BN-Sorcs1em1
Substrain: Mcwi
RGD ID: 4139875
Citation ID: RRID:RGD_4139875
Ontology ID: RS:0002429
Alleles: Sorcs1em1Mcwi
Also known as: FHH-1BN-Sorcs1em1Mcwi;FH.BN1Sorcs1em1Mcwi; FHH-Chr 1BNSorcs1em1Mcwi; FHH-Chr 1BN-Sorcs1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21249,080,662 - 249,594,520RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01269,965,824 - 270,473,097RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01277,404,996 - 277,912,261RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41255,767,411 - 256,279,565RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED
2014-03-25 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-Chr 1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED
2011-08-02 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-1BN-Sorcs1em1Mcwi    Symbol updated 68687 APPROVED
2011-08-02 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED
2011-08-02 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-1BN-Sorcs1em1Mcwi    Symbol updated 68687 APPROVED
2011-08-02 FHH-Chr 1BN-Sorcs1em1Mcwi    FHH-1BN-Sorcs1em1Mcwi    Name updated 68913 APPROVED