Strain: FHH-Chr 1BN-Sorcs1em1Mcwi

Symbol: FHH-Chr 1BN-Sorcs1em1Mcwi
Strain: FHH-Chr 1BN-Sorcs1em1
Substrain: Mcwi
Ontology ID: RS:0002429
Alleles: Sorcs1em1Mcwi
Also known as: FHH-1BN-Sorcs1em1Mcwi;FH.BN1Sorcs1em1Mcwi; FHH-Chr 1BNSorcs1em1Mcwi; FHH-Chr 1BN-Sorcs1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01269,965,824 - 270,473,097RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01277,404,996 - 277,912,261RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41255,767,411 - 256,279,565RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains

Experimental Data Annotations
References - curated

Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139875
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE