Strain: SS-Ets1em1Mcwi

Symbol: SS-Ets1em1Mcwi
Strain: SS-Ets1em1
Substrain: Mcwi
Ontology ID: RS:0002428
Alleles: Ets1em1Mcwi
Also known as: SS-Ets1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0833,756,634 - 33,879,625RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0833,798,598 - 33,921,593RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4832,481,694 - 32,545,237RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains

Experimental Data Annotations
References - curated

Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139874
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE