Strain Report - Rat Genome Database

Send us a Message

Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Ets1em1Mcwi

Symbol: SS-Ets1em1Mcwi
Strain: SS-Ets1em1
Substrain: Mcwi
RGD ID: 4139874
RRID: RGD_4139874
Ontology ID: RS:0002428
Alleles: Ets1em1Mcwi
Also known as: SS-Ets1em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2831,045,909 - 31,168,010RGD_MAPPER_PIPELINE
Rnor_6.0833,756,634 - 33,879,625RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0833,798,598 - 33,921,593RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4832,481,694 - 32,545,237RGD_MAPPER_PIPELINERGSC3.4


References - curated
1. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockout strains
3. RGD Automated Pipelines


Additional Information

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED