Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: WTC-Kcnq1dfkKyo

Symbol: WTC-Kcnq1dfkKyo
Strain: WTC-Kcnq1dfk
Substrain: Kyo
RGD ID: 2304242
Citation ID: RRID:RGD_2304242
Ontology ID: RS:0002278
Alleles: Kcnq1dfk;   Kcnq1
Also known as: WTC-Kcnq1dfk/Kyo; WTC-Kcnq1dfk/Kyo; WTC-dfk; deafness Kyoto; NBRP Rat No: 0289; WTC-Kcnq1dfkKyo
Type: mutant
Source: National BioResource Project for the Rat in Japan
Origin: Rats with abnormal behaviors such as head-tossing, drawing back, stepping back, and circling were discovered in the N12F10 generation of a WTC.ZI-Atrnzi congenic strain at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, in 1999. The WTC-Kcnq1dfk/Kyo rat is a mutant for circling behavior. although the Atrnzi allele of WTC.ZI-Atrnzi congenic rats was eliminated, the circling behavior remained.
Coat Color: Albino
Inbred Generations: F20
Last Known Status: Cryopreserved Sperm (as of 2017-04-05)
Research Usage Otorhinology; Internal Organ
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21198,291,711 - 198,624,683RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01216,293,087 - 216,630,339RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01223,154,713 - 223,490,458RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41203,383,401 - 203,803,687RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View


Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table

Clinical Measurement
heart rate
systolic blood pressure
body weight
body temperature
red blood cell count
blood hemoglobin level
white blood cell count
platelet count
hematocrit
mean corpuscular volume
plasma glucose level
plasma aspartate aminotransferase activity level
plasma alanine aminotransferase activity level
plasma alkaline phosphatase activity level
plasma total protein level
plasma albumin level
plasma phosphate level
plasma chloride level
plasma sodium level
plasma potassium level
heart wet weight
heart weight to body weight ratio
both kidneys wet weight
lung wet weight
urine potassium level
urine sodium level
brain weight to body weight ratio
both kidneys wet weight as percentage of body weight
liver weight as percentage of body weight
spleen weight to body weight ratio
brain wet weight
lung weight to body weight ratio
liver wet weight
both adrenal glands wet weight
spleen wet weight
both testes wet weight
activated partial thromboplastin time
prothrombin time
timed urine volume
mean corpuscular hemoglobin
mean corpuscular hemoglobin concentration
blood basophil count to total leukocyte count ratio
blood eosinophil count to total leukocyte count ratio
blood lymphocyte count to total leukocyte count ratio
blood monocyte count to total leukocyte count ratio
total plasma calcium level
urine chloride level
plasma creatinine level
plasma triglyceride level
plasma total cholesterol level
plasma urea nitrogen level
both adrenal glands weight to body weight ratio
plasma high density lipoprotein cholesterol level
plasma low density lipoprotein cholesterol level
both testes wet weight to body weight ratio
urine sodium excretion rate to body weight ratio
timed urine volume to body weight ratio
urine chloride excretion rate to body weight ratio
urine potassium excretion rate to body weight ratio
plasma total bilirubin level
blood segmented neutrophil count to total leukocyte count ratio
blood band neutrophil count to total leukocyte count ratio
non-specified leukocyte count to total leukocyte count ratio
plasma albumin to plasma total protein ratio

References


Region

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Kcnq1dfk-var1 chr1 216377021 216379067 AAGATGTCTGGACAGCATGTGCCCTGGCTGTCAGTCCTGGGTATAACCTCTAGACCCCAATGTGTACTCGTATCCTCATGGTCCCTCAGCTCAGCCAGTGATACATGTTCCCTCGTGTGCATATGAGTGTGAACAGGTATCCTTGTCTCCATGTGAGGCACGTTTACAACTGTTATGCCCACATATGTAGAACAGGGTGGTCCCTTTAAAGGGTGCAACCATGAATGGTTTGTTATGCCCTCTGTTTGTGTAGGGCATGGATTTGTTTAAGGACAATGACATTGTGGGGAAGATTTCATATGGGCAGTTGTGGGAAAACACCAGGATGCAGCCAATATAGCATGGTGCAGCACCGAAGGGGTGGCCCTGTGGTGGCCTGGACCCAGCTGTGGACTGCTCTGTTGTTTGCCATCCAGGAAAAATTGACCTGTTGCTTCATGACCTGTTAACATACTGGCCAGAGTGACAAACTTGGCGCTGTGGGGTTACTCTTGCTGTCCCTGTCCCCTGCTCCCCTGCTGCAGTTGGTCAGAGTGCTTACCTATGTTGTAAGCATCCATGTCTACACCCACTCATATGTACCTATTAACTTCTGACTCCCATGCCTCCCTTGCCTTCCCCTGCTCTTTGGTGGTCACTGGGGAACAGTTGTGGTCCACAGCAGTTCATCTGGGAATGGAGTGGGTAGTGATGACAGTGGGCTGGGGGTGGGGTGAGGATCTTGAGGCTTTCTCTCTGAGCCCCACATTAGTTGGTATCTATTAGGTGGTGTTTCCCAAGCCCCATCCTTGTTGACCCTATTGGGCAGAGGTTCACTTAGAGGTTCTTATGTAGATCCTGGCTGGGTGGTTGTTACCTGGCCCCCAAGGGGTAACACTCTAGGTGTCTAGAGTAATCAGGCTATAAAGACCTTGAATGGGCAGGTTCTCCTATCACACTAACCTGCCTTGACTGAAGGGCTGATCTGGACAGTGTTGTGACCCCGAGGGCTGTGTGTTAGTGAATGTAACTATTCTGTTCGCCTGGCAGGCCCAAGGCAGCCTCATGGTGTGACCTAGCGGTTAGGCACAGCCAGGGTGGGCCCCTGAGTCGCTCCCCAGGAGTAAACCTCAGATGTCAGCAGGGGGTTGCGGGGGGTAGCCCCCCTCACTCCTATTGNGTCCCACTGCATACCCTGGACGCTGCTCTCCCACCAAGAAGGCTAGAGCCTTGTCTTATTCTCTCTGAAAAGGAAAAATAAAACATCTGGATCCCTGGGGTGGTGGCAGGAAGCAGCATGTCAGGCCATCCTGGGCTTTGTGGACTGCTGGCCTCAGTGGGAGCTTCTGGCCTCCAGGGGGCCAGTGCACTGCAACTCTGGTGGCCGGGGAAGGGATCCTTAGGATGGGGCAGGAAGCCTGGCCCCTGTGGGTGGGCTCTGAGTTCTTTGCCTGTCTTGCACCCCCCCAAGCTGTCTGCAACCCTAGGGCTGTGCCATCTGTGGTAATCAGAGTTGAGGGACTTAGGAGACTCAGAAACTTGAACGAACTCATCATATTGCTGTCCCTGGTACTTTCTCAGAACCATGCCTCATTACCCTGGTGGGCAGGGTTTTAAGTTGGTCTTCTTGTCATCAAGCCACTGTGTTAGGGCTGGCAGATGTCCCTTCTGAGGCTCTGAGCCTGCCAGCCACTGACTGCAGTCCTTTTTCTTTACAGGTCACAGTCACCACCATTGGCTACGGGGATAAGGTACCCCAGACATGGGTTGGGAAGACCATCGCCTCCTGTTTCTCTGTCTTCGCCATATCCTTCTTTGCACTCCCAGCGGTGGGTACCCATTAAGACCCCTCTCCCTTGTTCCCCACTCACCTTTGCCCCAACTCCTAGGCATTCCTTGAAGTAGAGTAAGGAGGCCTTGGCACTTCACAGAAGCAGCAAGGTACAGGGGAGCAGACTGGGCAGAACCTGCAGCTCCACAGCCTGGAGTGGCTCTGTCCTTTGACTTTTCCAAAAATCACTAACCTATGTCTACACATGTGTGTTACATGGGACACACGCCGGTTACT - deletion

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_phys_biochem Prolonged QT interval in the electrocardiogram (ECG) 1302502
strain_reproduction Both male and female rats are fertile. 1302502

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-04-05 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Symbol updated 68687 APPROVED
2017-04-05 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Symbol updated 68687 APPROVED
2016-03-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Symbol updated 68687 APPROVED
2016-03-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Name updated 68913 APPROVED
2016-03-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Symbol updated 68687 APPROVED
2016-03-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Name updated 68913 APPROVED
2012-05-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Name updated 68913 APPROVED
2012-05-16 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfkKyo    Name updated 68913 APPROVED
2010-06-08 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfk/Kyo    Symbol updated 68687 APPROVED
2010-06-08 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfk/Kyo    Name updated 68913 APPROVED
2010-06-08 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfk/Kyo    Symbol updated 68687 APPROVED
2010-06-08 WTC-Kcnq1dfkKyo    WTC-Kcnq1dfk/Kyo    Name updated 68913 APPROVED