Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Leprem4Lizh

Symbol: SD-Leprem4Lizh
Strain: SD-Leprem4
Substrain: Lizh
RGD ID: 21079475
Citation ID: RRID:RGD_21079475
Ontology ID: RS:0005012
Type: mutant
Source: Chinese Academy of Medical Sciences & Comparative Medical Center, Peking Union Medical College, China
Origin: The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.
Genetic Status: Homozygous
Last Known Status: Unknown





References

References - curated
# Reference Title Reference Citation
1. Preliminary Characterization of a Leptin Receptor Knockout Rat Created by CRISPR/Cas9 System. Bao D, etal., Sci Rep. 2015 Nov 5;5:15942. doi: 10.1038/srep15942.

Region


Additional Information