Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: LE-Gad1em15Yyan

Symbol: LE-Gad1em15Yyan
Strain: LE-Gad1em15
Substrain: Yyan
RGD ID: 149735560
Citation ID: RRID:RGD_149735560
Ontology ID: RS:0004999
Alleles: Gad1em15Yyan
Also Known As: NBRP Rat No: 0906; LE-Gad1^[em15Yyan]
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: Gunma University Graduate School of Medicine
Description: Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes.
Coat Color: Black hood
Inbred Generations: F2 -F3
Last Known Status: Cryopreserved Sperm (as of 2021-07-22)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2355,386,152 - 55,386,442RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0356,861,440 - 56,902,139RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0363,479,963 - 63,519,879RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4352,789,370 - 52,830,038RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Impact of GAD65 and/or GAD67 deficiency on perinatal development in rats. Jiang W, etal., FASEB J. 2022 Feb;36(2):e22123. doi: 10.1096/fj.202101389R.
2. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Gad1em15Yyan-var1 chr3 55386152 55386442 TAATGGTTGGCCATCTTCTTCCCCCTTCTCCAGCTCGGAGAGCTCCATCAGACCATGGGACAGATCAAGTCACGTGCT CCAGCCCTTTGCTCTGAAGATAGCTTGGAAAATCCAGCTTTGCCTTAATGCTTGCCTGTTATCTCTCTAGGTCACCCT CGGTTTTTCAACCAGCTCTCTACTGGTTTGGATATCATTGGTTTAGCTGGCGAATGGCTGACATCAACTGCCAATACC AATATGTAAGTCTCACGTGTTCCTTTCCTATATGCACACATGATGTATATGGCTTGT - deletion mRatBN7.2

Additional Information