Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Kcnj2em2Mcwi

Symbol: SS-Kcnj2em2Mcwi
Strain: SS-Kcnj2em2
Substrain: Mcwi
RGD ID: 14394494
Citation ID: RRID:RGD_14394494
Ontology ID: RS:0004688
Alleles: Kcnj2em2Mcwi
Also Known As: SS-Kcnj2^[em2Mcwi]
Type: mutant
Available Source: Contact MCW rat distribution at mcwcustomrats@mcw.edu
Origination: MCW Gene Editing Rat Resource Center
Description: CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos.
Last Known Status: Cryopreserved Sperm (as of 2019-03-22)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21096,066,338 - 96,066,365RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01099,429,337 - 99,442,520RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01099,125,234 - 99,134,077RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.410100,574,985 - 100,576,268RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Kcnj2em2Mcwi-var1 chr10 96066338 96066365 GCCACCATGGCCGTCGCCAATGGCTTTG - deletion mRatBN7.2

Additional Information