Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Abcc6em2Qlju+/+

Symbol: SD-Abcc6em2Qlju+/+
Strain: SD-Abcc6em2+/Abcc6em2+
Substrain: Qlju
Ontology ID: RS:0004628
Type: mutant
Source: Thomas Jefferson University, Philadelphia
Origin: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants.
Genetic Status: Wild Type
Last Known Status: Unknown





Experimental Data Annotations
Phenotype Values via Phenominer
References - curated

Region


Additional Information

 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 13792683
Created: 2018-09-20
Species: Rattus norvegicus
Last Modified: 2018-09-20
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.