Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Abcc6em2Qlju+/-

Symbol: SD-Abcc6em2Qlju+/-
Strain: SD-Abcc6em2+/Abcc6em2-
Substrain: Qlju
RGD ID: 13792682
Citation ID: RRID:RGD_13792682
Ontology ID: RS:0004627
Alleles: Abcc6em2Qlju
Type: mutant
Source: Thomas Jefferson University, Philadelphia
Origin: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Genetic Status: Heterozygous
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2196,447,224 - 96,501,464RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01101,954,786 - 102,013,252RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01103,042,723 - 103,096,453RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4196,448,588 - 96,524,655RGD_MAPPER_PIPELINERGSC3.4





References

References - curated
# Reference Title Reference Citation
1. Abcc6 Knockout Rat Model Highlights the Role of Liver in PPi Homeostasis in Pseudoxanthoma Elasticum. Li Q, etal., J Invest Dermatol. 2017 May;137(5):1025-1032. doi: 10.1016/j.jid.2016.11.042. Epub 2017 Jan 19.

Region


Additional Information