Strain Report - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: SD-Nfe2l2em1Mcwi-/-

Symbol: SD-Nfe2l2em1Mcwi-/-
Strain: SD-Nfe2l2em1-/Nfe2l2em1-
Substrain: Mcwi
Full Name: SD-Nfe2l2em1Mcwi-/Nfe2l2em1Mcwi-
RGD ID: 13208518
Citation ID: RRID:RGD_13208518
Ontology ID: RS:0004501
Alleles: Nfe2l2em1Mcwi
Previously known as: Nrf2-/-; SD-Nfe2l2em1Mcwi-/-
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.
Genetic Status: Homozygous
Last Known Status: Live Animals (as of 2017-08-09)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2360,594,239 - 60,621,785RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0362,497,568 - 62,525,146RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0369,041,641 - 69,069,190RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4358,366,693 - 58,394,116RGD_MAPPER_PIPELINERGSC3.4





Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. The NRF2 knockout rat: a new animal model to study endothelial dysfunction, oxidant stress, and microvascular rarefaction. Priestley JR, etal., Am J Physiol Heart Circ Physiol. 2016 Feb 15;310(4):H478-87. doi: 10.1152/ajpheart.00586.2015. Epub 2015 Dec 4.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nfe2l2em1Mcwi-var1 chr3 60621570 60621610 TGTAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAG - deletion mRatBN7.2
Nfe2l2em1Mcwi-var1 chr3 62524893 62524933 TGTAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAG - deletion Rnor_6.0

Additional Information