Strain: SD-Nfe2l2em1Mcwi-/-

Symbol: SD-Nfe2l2em1Mcwi-/-
Strain: SD-Nfe2l2em1-/Nfe2l2em1-
Substrain: Mcwi
Full Name: SD-Nfe2l2em1Mcwi-/Nfe2l2em1Mcwi-
Ontology ID: RS:0004501
Alleles: Nfe2l2em1Mcwi
Also known as: Nrf2-/-; SD-Nfe2l2em1Mcwi-/-
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.
Genetic Status: Homozygous
Last Known Status: Live Animals (as of 2017-08-09)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0362,497,568 - 62,525,146RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0369,041,641 - 69,069,190RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4358,366,693 - 58,394,116RGD_MAPPER_PIPELINERGSC3.4

Phenotype Annotations
Experimental Data Annotations
Phenotype Values via Phenominer
References - curated
RGD Disease Portals

Additional Information

More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 13208518
Created: 2017-08-09
Species: Rattus norvegicus
Last Modified: 2017-08-09
Status: ACTIVE