Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Nfe2l2em1Mcwi+/+

Symbol: SD-Nfe2l2em1Mcwi+/+
Strain: SD-Nfe2l2em1+/Nfe2l2em1+
Substrain: Mcwi
Full Name: SD-Nfe2l2em1Mcwi+/Nfe2l2em1Mcwi+
RGD ID: 13208517
Citation ID: RRID:RGD_13208517
Ontology ID: RS:0004500
Also Known As: SD-Nfe2l2em1Mcwi+/+; SD-Nfe2l2^[em1Mcwi+/+]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.Founders were backcrossed with Crl:SD to get heterozygous offspring which were intercrossed and offspring maintained as homozygous and heterozygous breeders.
Genetic Status: Wild Type
Last Known Status: Live Animals (as of 2017-08-09)





References

Region


Additional Information