Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Lepem1Sage-/-

Symbol: SD-Lepem1Sage-/-
Strain: SD-Lepem1-/Lepem1-
Substrain: Sage
RGD ID: 12904912
Citation ID: RRID:RGD_12904912
Ontology ID: RS:0004449
Alleles: Lepem1Sage
Previously known as: SD- Lep tm1sage; Leptin Knockout Rat -KiloRat-TM; TGRA3780 ; SD-Lepem1Sage
Type: mutant
Source: Horizon Discovery
Origin: This ZFN model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels
Genetic Status: Homozygous
Last Known Status: Cryopreserved Embryo (as of 2017-05-24)
Research Usage Cardiovascular
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2457,661,127 - 57,675,262RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0456,337,695 - 56,351,818RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0456,085,079 - 56,099,209RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4455,943,837 - 55,945,938RGD_MAPPER_PIPELINERGSC3.4





References

References - curated
# Reference Title Reference Citation
1. Creation and preliminary characterization of a leptin knockout rat. Vaira S, etal., Endocrinology. 2012 Nov;153(11):5622-8. doi: 10.1210/en.2012-1462. Epub 2012 Sep 4.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Lepem1Sage-var1 chr4 57670525 57670675 ATCCACAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTAGGGAGTCTCTTGTGGGGAAGCAAAGGAGAAGTAGGGCTAGAACCAGAGTCTGAGAATCACAGTGAGCGCCTTC - deletion mRatBN7.2
Lepem1Sage-var1 chr4 56347081 56347231 ATCCACAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTAGGGAGTCTCTTGTGGGGAAGCAAAGGAGAAGTAGGGCTAGAACCAGAGTCTGAGAATCACAGTGAGCGCCTTC - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2018-09-13 SD-Lepem1Sage-/-    SD-Lepem1Sage    Symbol updated 68687 APPROVED
2018-09-13 SD-Lepem1Sage-/-    SD-Lepem1Sage    Symbol updated 68687 APPROVED