Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Abcc6em4Qlju-/-

Symbol: SD-Abcc6em4Qlju-/-
Strain: SD-Abcc6em4-/Abcc6em4-
Substrain: Qlju
Ontology ID: RS:0004087
Alleles: Abcc6em4Qlju
Also known as: SD-Abcc6em4Qlju
Type: mutant
Source: Thomas Jefferson University, Philadelphia
Origin: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Last Known Status: Unknown
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01101,954,786 - 102,013,252RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01103,042,723 - 103,096,453RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4196,448,588 - 96,524,655RGD_MAPPER_PIPELINERGSC3.4

Disease Annotations
Experimental Data Annotations
References - curated


Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 10413856
Created: 2015-11-25
Species: Rattus norvegicus
Last Modified: 2016-12-08
Status: ACTIVE


RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.