Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: DA-Glaem2Mcwi

Symbol: DA-Glaem2Mcwi
Strain: DA-Glaem2
Substrain: Mcwi
RGD ID: 10054398
Citation ID: RRID:RGD_10054398
Ontology ID: RS:0003988
Alleles: Glaem2Mcwi
Also Known As: DA-Glaem2Mcwi; DA-Gla^[em2Mcwi]
Type: mutant
Available Source: Contact MCW rat distribution at mcwcustomrats@mcw.edu
Origination: MCW Gene Editing Rat Resource Center
Description: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2018-10-22)
Genotyping Protocol Download Genotyping Protocol
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X97,769,227 - 97,780,646RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0X105,405,915 - 105,417,331RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0X105,301,986 - 105,302,032RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4X122,044,703 - 122,056,327RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
abnormal circulating cytokine level  (IMP)
abnormal glycosphingolipid level  (IMP)
abnormal lens fiber morphology  (IMP)
abnormal lysosome morphology  (IMP)
abnormal megakaryocyte progenitor cell morphology  (IMP)
abnormal motor neuron morphology  (IMP)
abnormal myeloid cell number  (IMP)
abnormal myeloid leukocyte morphology  (IMP)
abnormal platelet morphology  (IMP)
abnormal proximal convoluted tubule morphology  (IMP)
abnormal reticulocyte cell number  (IMP)
abnormal reticulocyte morphology  (IMP)
abnormal retina blood vessel morphology  (IMP)
abnormal sebaceous gland morphology  (IMP)
abnormal sensory neuron morphology  (IMP)
abnormal sleep duration  (IMP)
abnormal sphingolipid level  (IMP)
abnormal survival  (IMP)
allodynia  (IMP)
alopecia  (IMP)
cornea opacity  (IMP)
decreased body weight  (IMP)
decreased cardiac muscle contractility  (IMP)
decreased circulating cholesterol level  (IMP)
decreased circulating glucose level  (IMP)
decreased circulating serum albumin level  (IMP)
decreased circulating total protein level  (IMP)
decreased grooming behavior  (IMP)
decreased heart left ventricle wall thickness  (IMP)
decreased locomotor activity  (IMP)
decreased mean corpuscular hemoglobin  (IMP)
decreased mean corpuscular volume  (IMP)
decreased mechanical nociceptive threshold  (IMP)
hyperresponsive to tactile stimuli  (IMP)
increased blood urea nitrogen level  (IMP)
increased body weight  (IMP)
increased circulating alkaline phosphatase level  (IMP)
increased circulating aspartate transaminase level  (IMP)
increased circulating interleukin-17 level  (IMP)
increased circulating potassium level  (IMP)
increased circulating tumor necrosis factor level  (IMP)
increased erythrocyte cell number  (IMP)
increased macrophage cell number  (IMP)
increased renal glomerular filtration rate  (IMP)
increased tongue size  (IMP)
increased urine calcium level  (IMP)
increased urine flow rate  (IMP)
increased urine glucose level  (IMP)
lipidosis  (IMP)
long tongue  (IMP)
lysosomal protein accumulation  (IMP)
nervous system inclusion bodies  (IMP)
neuron hypertrophy  (IMP)
renal glomerulus atrophy  (IMP)
rough coat  (IMP)
thick mitral valve  (IMP)
thrombocytosis  (IMP)

References

References - curated
# Reference Title Reference Citation
1. HomeCageScan analysis reveals ongoing pain in Fabry rats. Burand AJ, etal., Neurobiol Pain. 2023 Jan 5;13:100113. doi: 10.1016/j.ynpai.2022.100113. eCollection 2023 Jan-Jul.
2. Fabry Disease Rat Model Develops Age- and Sex-Dependent Anterior Segment Ocular Abnormalities. Erdman ME, etal., Invest Ophthalmol Vis Sci. 2024 Aug 1;65(10):14. doi: 10.1167/iovs.65.10.14.
3. Platelet and myeloid cell phenotypes in a rat model of Fabry disease. Kanack AJ, etal., FASEB J. 2021 Aug;35(8):e21818. doi: 10.1096/fj.202001727RR.
4. α-Galactosidase A-deficient rats accumulate glycosphingolipids and develop cardiorenal phenotypes of Fabry disease. Miller JJ, etal., FASEB J. 2019 Jan;33(1):418-429. doi: 10.1096/fj.201800771R. Epub 2018 Jul 6.
5. Neuropathic pain in a Fabry disease rat model. Miller JJ, etal., JCI Insight. 2018 Mar 22;3(6). pii: 99171. doi: 10.1172/jci.insight.99171.
6. Rats deficient in α-galactosidase A develop ocular manifestations of Fabry disease. Miller JJ, etal., Sci Rep. 2019 Jun 28;9(1):9392. doi: 10.1038/s41598-019-45837-1.
7. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators
8. RGD Strain RSO annotation pipeline RGD Automated Pipelines
9. Fabry disease Schwann cells release p11 to induce sensory neuron hyperactivity. Waltz TB, etal., JCI Insight. 2024 Mar 7;9(8):e172869. doi: 10.1172/jci.insight.172869.
10. Sensory-specific peripheral nerve pathology in a rat model of Fabry disease. Waltz TB, etal., Neurobiol Pain. 2021 Sep 2;10:100074. doi: 10.1016/j.ynpai.2021.100074. eCollection 2021 Aug-Dec.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Glaem2Mcwi-var1 chrX 105301986 105302032 CCTCTCGGGAGCCATCCAGCAGTCATCTATGCAGAGGTATTCATAAC - deletion Rnor_5.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-03-16 DA-Glaem2Mcwi    DA-Glaem2Mcwi    Symbol updated 68687 APPROVED
2016-03-16 DA-Glaem2Mcwi    DA-Glaem2Mcwi    Name updated 68913 APPROVED
2016-03-16 DA-Glaem2Mcwi    DA-Glaem2Mcwi    Symbol updated 68687 APPROVED
2016-03-16 DA-Glaem2Mcwi    DA-Glaem2Mcwi    Name updated 68913 APPROVED