Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi

Symbol: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7
Substrain: Mcwi
RGD ID: 10054307
Citation ID: RRID:RGD_10054307
Ontology ID: RS:0003973
Alleles: Btg2em7Mcwi
Also Known As: SS-Chr 13BN-Btg2em7Mcwi; SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi; SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi; SS.BN-(D13Rat25-rs106935835)-Btg2^[em7Mcwi]
Type: mutant
Available Source: Contact MCW rat distribution at mcwcustomrats@mcw.edu
Origination: MCW Gene Editing Rat Resource Center
Description: The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21345,535,467 - 45,535,510RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01350,913,185 - 50,916,944RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01355,966,299 - 55,970,058RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41347,026,986 - 47,030,745RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Region

Position Markers

Flank 1 / null (D13Rat25)
Rat AssemblyChrPosition (strand)Source
mRatBN7.21345,049,404 - 45,049,579 (-)MAPPER
Rnor_6.01350,260,357 - 50,260,531NCBI
Rnor_5.01355,314,020 - 55,314,194UniSTS
RGSC_v3.41346,520,765 - 46,520,939UniSTS
RGSC_v3.41346,520,127 - 46,520,301UniSTS
RGSC_v3.41346,520,764 - 46,520,939RGD
RGSC_v3.41346,520,126 - 46,520,301RGD
RGSC_v3.11346,534,808 - 46,534,982RGD
Celera1345,381,673 - 45,381,847UniSTS
RH 3.4 Map13174.3RGD
RH 3.4 Map13174.3UniSTS
RH 2.0 Map13375.1RGD
SHRSP x BN Map1314.7498RGD
FHH x ACI Map1318.23RGD
Cytogenetic Map13q13UniSTS

Flank 2 / null (rs106935835)
Rat AssemblyChrPosition (strand)Source
Rnor_6.01350,918,009 - 50,918,009RGD
Rnor_5.01355,971,123 - 55,971,123RGD
RGSC_v3.41347,031,810 - 47,031,810RGD
Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Btg2em7Mcwi-var1 chr13 45535467 45535510 AAACCTTGAGTCTCTGCTCGCTCACGCAGCCCCGAGTCCTCAGG - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-07-19 SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2017-07-19 SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Name updated 68913 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Name updated 68913 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-04 SS-Chr 13BN-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-04 SS-Chr 13BN-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED