Strain Report - Rat Genome Database

Send us a Message

Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi

Symbol: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7
Substrain: Mcwi
RGD ID: 10054307
RRID: RGD_10054307
Ontology ID: RS:0003973
Alleles: Btg2em7Mcwi
Also known as: SS-Chr 13BN-Btg2em7Mcwi; SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi; SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
Type: mutant
Source: MCW Gene Editing Rat Resource Center
Origin: The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.
Last Known Status: Unknown (as of 2020-01-23)
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21345,531,881 - 45,535,642RGD_MAPPER_PIPELINE
Rnor_6.01350,913,185 - 50,916,944RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01355,966,299 - 55,970,058RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41347,026,986 - 47,030,745RGD_MAPPER_PIPELINERGSC3.4


References - curated
1. Personal communication between Dr. Melinda Dwinell’s group and the RGD curators


Position Markers

Flank 1 / null (D13Rat25)
Rat AssemblyChrPosition (strand)Source
mRatBN7.21345,049,404 - 45,049,579 (-)MAPPER
Rnor_6.01350,260,357 - 50,260,531NCBI
Rnor_5.01355,314,020 - 55,314,194UniSTS
RGSC_v3.41346,520,765 - 46,520,939UniSTS
RGSC_v3.41346,520,127 - 46,520,301UniSTS
RGSC_v3.41346,520,764 - 46,520,939RGD
RGSC_v3.41346,520,126 - 46,520,301RGD
RGSC_v3.11346,534,808 - 46,534,982RGD
Celera1345,381,673 - 45,381,847UniSTS
RH 3.4 Map13174.3RGD
RH 3.4 Map13174.3UniSTS
RH 2.0 Map13375.1RGD
SHRSP x BN Map1314.7498RGD
FHH x ACI Map1318.23RGD
Cytogenetic Map13q13UniSTS

Flank 2 / null (rs106935835)
Rat AssemblyChrPosition (strand)Source
Rnor_6.01350,918,009 - 50,918,009RGD
Rnor_5.01355,971,123 - 55,971,123RGD
RGSC_v3.41347,031,810 - 47,031,810RGD

Additional Information

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-07-19 SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2017-07-19 SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Name updated 68913 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Name updated 68913 APPROVED
2016-03-16 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-07 SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Symbol updated 68687 APPROVED
2015-08-04 SS-Chr 13BN-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED
2015-08-04 SS-Chr 13BN-Btg2em7Mcwi    SS-Chr 13BN-Btg2em7Mcwi    Name updated 68913 APPROVED