Strain: WI-Foxn1em2Nips

Symbol: WI-Foxn1em2Nips
Strain: WI-Foxn1em2
Substrain: Nips
Ontology ID: RS:0003949
Alleles: Foxn1em2Nips
Also known as: WI-Foxn1em2Nips
Type: mutant
Source: Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Origin: Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 60-bp frameshift deletion in exon 1 (del 46-105).
Coat Color: Albino
Last Known Status: Unknown
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01065,621,142 - 65,634,666RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01066,004,940 - 66,030,134RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41064,243,323 - 64,256,847RGD_MAPPER_PIPELINERGSC3.4

Disease Annotations
Experimental Data Annotations
References - curated

Additional Information

RGD Curation Notes
Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 10053601
Created: 2015-07-15
Species: Rattus norvegicus
Last Modified: 2016-12-12
Status: ACTIVE