Kcnmb1em3Mcwi-var1Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Variant: Kcnmb1em3Mcwi-var1 -  Rattus norvegicus

Name: Kcnmb1em3Mcwi-var1
RGD ID: 329849030
Description: Variant associated with allele Kcnmb1em3Mcwi; this allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692)
Type: deletion (SO:0000159)
Associated Allele:  Kcnmb1em3Mcwi
Reference Nucleotide: CAGAAAAGGTACAGATCTCTC
Variant Nucleotide:
Position
Rat AssemblyChrPosition (strand)Source
mRatBN7.21018,559,674 - 18,559,694 (+)RGD




Related Rat Strains
The following Strains have been annotated to Kcnmb1em3Mcwi-var1


Additional Information