Ednrbsl-var1Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Variant: Ednrbsl-var1 -  Rattus norvegicus

Name: Ednrbsl-var1
RGD ID: 14349047
Description: Variant associated with spotting lethal allele, Ednrbsl
Type: deletion (SO:0000159)
Associated Allele:  Ednrbsl
Reference Nucleotide: CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT
Variant Nucleotide:
Position
Rat AssemblyChrPosition (strand)Source
mRatBN7.21580,670,748 - 80,671,048 (+)RGD
Rnor_6.01588,034,987 - 88,035,287 (+)RGD
Aliases: NC_005114.4:g.88034987_88035287del




Related Rat Strains
The following Strains have been annotated to Ednrbsl-var1


References - curated
# Reference Title Reference Citation
1. Null mutation of endothelin receptor type B gene in spotting lethal rats causes aganglionic megacolon and white coat color. Gariepy CE, etal., Proc Natl Acad Sci U S A 1996 Jan 23;93(2):867-72.

Additional Information