Srm Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Srm

Symbol: Srm
Also known as:
RGD ID: 7206072
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.05165,407,456 - 165,408,136NCBIRnor6.0
Rnor_6.0314,591,103 - 14,591,783NCBIRnor6.0
Rnor_5.05169,064,057 - 169,064,737UniSTSRnor5.0
Rnor_5.0319,902,435 - 19,903,115UniSTSRnor5.0
Celera5157,304,334 - 157,305,014UniSTS
Celera313,422,895 - 13,423,336UniSTS
Cytogenetic Map5q36UniSTS
Is Marker For: Genes:   Srm   LOC100364487   LOC100912604  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTCCTATTACCAGCTCATG
Reverse Primer CTGGTCCAGGACTGGTGGTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
6485978LOC100912604spermidine synthase-like31458881814591980Rat
620796Srmspermidine synthase5165405168165408325Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3125786001Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3128136884Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3128500807Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3128500807Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3132972944Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3137891710Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3139773425Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3263142133477544Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3328592928136884Rat
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3328592928136884Rat
8693641Alc30Alcohol consumption QTL 3020.739drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)3565463925105730Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)3600086634394121Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
11528620Bss113Bone structure and strength QTL 1139.750.00000000017femur morphology trait (VT:0000559)femoral neck width (CMO:0001695)31223622115217668Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691441510346Rat
2325840Bp345Blood pressure QTL 3450.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041129084626Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
2302369Scl60Serum cholesterol level QTL 603.13blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)5149568588167739697Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5142309061173707219Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132551937173707219Rat
1331721Bp210Blood pressure QTL 2103.413arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5149029982173687766Rat
1298090Bp155Blood pressure QTL 1553.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)5157212422167739539Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5142307322173707219Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5136354114173707219Rat
631272Lanf1Left ventricular atrial natriuretic factor QTL 112heart left ventricle natriuretic peptide A amount (VT:0010596)heart left ventricle natriuretic peptide A level (CMO:0002165)5157319671173707219Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5138154677172402610Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)584963058173504662Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5128687766173687766Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5133943857173707219Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5133943857173707219Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5134197905173707219Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)547745646167946134Rat
1354631Swd2Spike wave discharge measurement QTL 23.640.0002brain electrophysiology trait (VT:0010557)brain total spike-and-wave discharge duration (CMO:0001740)5157319671171194163Rat
1549904Neuinf1Neuroinflammation QTL 130nervous system integrity trait (VT:0010566)blood T lymphocyte count (CMO:0000110)5161084664173707219Rat
2313096Bmd78Bone mineral density QTL 783.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)5150360936167946134Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)561612600168109659Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5136640731173707219Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5134712342173707219Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5134712342173707219Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5131077716173707219Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100364487 UniSTS
  100912604 UniSTS
  84596 UniSTS
UniGene Rn.217060 UniSTS
  Rn.22258 UniSTS
UniSTS 531490 UniSTS