GAK__6772 Marker Search Result - Rat Genome Database

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

General

Marker: GAK__6772

Symbol:

GAK__6772

Also known as:

Expected Size:

498 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_6.0	14	2,173,821 - 2,174,318	NCBI	Rnor6.0
Rnor_6.0	13	4,656,799 - 4,657,297	NCBI	Rnor6.0
Rnor_5.0	14	2,168,440 - 2,168,937	UniSTS	Rnor5.0
Rnor_5.0	13	4,633,864 - 4,634,362	UniSTS	Rnor5.0
Celera	14	1,202,997 - 1,203,494	UniSTS
Celera	13	3,084,268 - 3,084,766	UniSTS
Cytogenetic Map	14	p22	UniSTS

Is Marker For:

Genes: Gak LOC100910338

Annotation

References - curated

1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GATCTTCATGGAGCTGAA
Reverse Primer	CATCGGAAAATAGTTTAATTC

Region

Genes in Region (Rnor_6.0)

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
6498838	LOC100910338	cyclin-G-associated kinase-like	13	4651876	4666182	Rat
621589	Gak	cyclin G associated kinase	14	2100104	2174332	Rat

Nucleotide Sequences

RefSeq Transcripts	NM_031030	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BV445043	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	D38560	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH617708	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (Rnor_6.0)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2317027	Aia22	Adjuvant induced arthritis QTL 22	2.29		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	13	1	36779181	Rat
738036	Lnnr4	Liver neoplastic nodule remodeling QTL 4	3.64		liver integrity trait (VT:0010547)	liver remodeling tumorous lesion number (CMO:0001461)	13	1	47622148	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	1	107975663	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	1	107975663	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	1	107975663	Rat
2300159	Bmd61	Bone mineral density QTL 61	5.3	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	14	1	27597761	Rat
2300183	Bmd60	Bone mineral density QTL 60	5.7	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	14	1	27597761	Rat
619619	Rf4	Renal disease susceptibility QTL 4	4.1	0.002	total urine protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	14	1	34403399	Rat
9589814	Gluco67	Glucose level QTL 67	4.54	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	14	1	41333960	Rat
7411573	Bw139	Body weight QTL 139	4.7	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	14	1	41333960	Rat
634352	Apr6	Acute phase response QTL 6	3.7		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	14	1	42766285	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100910338	UniSTS
	81659	UniSTS
UniGene	Rn.11012	UniSTS
UniSTS	466196	UniSTS

More on GAK__6772
	JBrowse: rn5 rn6
	Ensembl
	NCBI

RGD Object Information
RGD ID:	7205848
Created:	2013-01-15
Species:	Rattus norvegicus
Last Modified:	2014-08-05
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.