Mobp Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Mobp

Symbol: Mobp
Also known as:
RGD ID: 7204561
Expected Size: 306 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389120,180,469 - 120,180,774UniSTSGRCm38
MGSCv379120,089,587 - 120,089,892UniSTSGRCm37
Celera9120,649,266 - 120,649,571UniSTS
Cytogenetic Map9F4UniSTS
Is Marker For: Genes:   Mobp  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GACCAGGTAGGTAGGAAAGGAC
Reverse Primer AGCATTCTGAGCCATCTCTTCC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3702883 UniSTS
NCBI Gene 17433 UniSTS
UniGene Mm.432562 UniSTS
UniSTS 498786 UniSTS