Mobp Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Mobp

Symbol: Mobp
Also known as:
RGD ID: 7204403
Expected Size: 205 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389120,181,152 - 120,181,355UniSTSGRCm38
MGSCv379120,090,270 - 120,090,473UniSTSGRCm37
Celera9120,649,949 - 120,650,152UniSTS
Cytogenetic Map9F4UniSTS
cM Map969.0UniSTS
Is Marker For: Genes:   Mobp  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCTGAGTGCTCGTTTGTCTCC
Reverse Primer CCCATCAGCTTCAAGCAATCTC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:8430 UniSTS
NCBI Gene 17433 UniSTS
UniGene Mm.432562 UniSTS
UniSTS 143890 UniSTS