Myo9b Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Myo9b

Symbol: Myo9b
Also known as: UniSTS:259375; 
RGD ID: 7203365
Expected Size: 615 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38871,359,407 - 71,360,021UniSTSGRCm38
MGSCv37873,883,306 - 73,883,920UniSTSGRCm37
Celera873,882,488 - 73,883,102UniSTS
Cytogenetic Map8B3.3UniSTS
Is Marker For: Genes:   Myo9b  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTGAGAGCCTGCTGGAGGAGA
Reverse Primer GATGCCAGTTCGGGGATGTTAG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:2669601 UniSTS
NCBI Gene 17925 UniSTS
UniGene Mm.33779 UniSTS
UniSTS 259375 UniSTS