Trh Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Trh

Symbol: Trh
Also known as:
RGD ID: 7200647
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38692,242,406 - 92,243,723UniSTSGRCm38
MGSCv37692,192,400 - 92,193,717UniSTSGRCm37
Celera694,138,017 - 94,139,331UniSTS
Cytogenetic Map6D1UniSTS
Is Marker For: Genes:   Trh  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCTTGAGGAAAGACCTCCAGCGT
Reverse Primer TGGCTCTTTGAAGTTCCTGAAGTG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3759823 UniSTS
NCBI Gene 22044 UniSTS
UniSTS 507403 UniSTS