Trh Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Trh

Symbol: Trh
Also known as:
RGD ID: 7200645
Expected Size: 442 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38692,242,406 - 92,242,847UniSTSGRCm38
MGSCv37692,192,400 - 92,192,841UniSTSGRCm37
Celera694,138,017 - 94,138,458UniSTS
Cytogenetic Map6D1UniSTS
Is Marker For: Genes:   Trh  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGATGGAGTCTGATGTCACCAAG
Reverse Primer TGGCTCTTTGAAGTTCCTGAAGTG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3759828 UniSTS
NCBI Gene 22044 UniSTS
UniSTS 507404 UniSTS