Ybx2 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Ybx2

Symbol: Ybx2
Also known as:
RGD ID: 7199781
Expected Size: 1338 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381169,940,087 - 69,941,424UniSTSGRCm38
Celera1177,488,058 - 77,489,395UniSTS
Cytogenetic Map11B4UniSTS
Is Marker For: Genes:   Ybx2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCACCACCCTTCTTCTATCGA
Reverse Primer GGTGATGCCTCGGAACAATA
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4948904 UniSTS
NCBI Gene 53422 UniSTS
UniSTS 532523 UniSTS