Ephb1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Ephb1

Symbol: Ephb1
Also known as:
RGD ID: 7199245
Expected Size: 229 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389101,923,182 - 101,923,411UniSTSGRCm38
MGSCv379101,825,512 - 101,825,741UniSTSGRCm37
Celera9101,459,383 - 101,459,612UniSTS
Cytogenetic Map9F1UniSTS
cM Map9 UniSTS
Is Marker For: Genes:   Ephb1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGAATGTGCCAGAAAGATCAG
Reverse Primer TCTCAGATGGGAACCGAGTTC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3029516 UniSTS
NCBI Gene 270190 UniSTS
UniGene Mm.22897 UniSTS
UniSTS 266991 UniSTS