ATP5B Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: ATP5B

Symbol: ATP5B
Also known as:
RGD ID: 7198917
Expected Size: 137 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381771,459,426 - 71,459,562UniSTSGRCm38
GRCm3810128,084,331 - 128,084,467UniSTSGRCm38
MGSCv371771,808,766 - 71,808,902UniSTSGRCm37
MGSCv3710127,521,387 - 127,521,523UniSTSGRCm37
Celera1775,729,798 - 75,729,934UniSTS
Celera10130,479,068 - 130,479,204UniSTS
Cytogenetic Map17E1.3UniSTS
Cytogenetic Map10D3UniSTS
Is Marker For: Genes:   Smchd1   Atp5b   Mir677   Gm4707  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CACGGAAGGCTTGGTTAGAG
Reverse Primer TGGTTTTGATGGGACCTCTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1553193Smchd1SMC hinge domain containing 1177134448971475366Mouse
2299234Gm4707predicted gene 4707177145817871459899Mouse
1557957Atp5bATP synthase, H+ transporting mitochondrial F1 complex, beta subunit10128083307128090388Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1301338Lmr1_mleishmaniasis resistance 1 (mouse)Not determined17986241186688972Mouse
4142150Stheal11_msoft tissue heal 11 (mouse)Not determined171206732483054339Mouse
1300592Pcyts5_mplasmacytoma susceptibility 5 (mouse)Not determined173840588672405969Mouse
10755525Lymph2_mlymphocyte differential 2 (mouse)173849862572498625Mouse
10755534Lymph4_mlymphocyte differential 4 (mouse)173849862572498625Mouse
4141319Hmtb8_mhemostasis and thrombosis rebleeding time 8 (mouse)Not determined4022744774227623Mouse
15039324Nmrs48_mNAFLD-associated magnetic resonance shift 48 (mouse)174063218774632187Mouse
26884428Cvht3_mcranial vault height 3, 5 week (mouse)174620000082100000Mouse
1357754Ahl3_mage related hearing loss 3 (mouse)Not determined174989696283897108Mouse
1357532Bmch7_mbone mechanical trait 7 (mouse)Not determined175145143085451617Mouse
4141879Chlq9_mcirculating hormone level QTL 9 (mouse)Not determined175145143085451617Mouse
4141758Pstc5_mperiosteal circumference 5 (mouse)Not determined175680065690800808Mouse
4141011Bmd26_mbone mineral density 26 (mouse)Not determined175680065690800808Mouse
1300735Pgia20_mproteoglycan induced arthritis 20 (mouse)Not determined175680065690800808Mouse
1357447Heal13_mwound healing/regeneration 13 (mouse)Not determined175680065690800808Mouse
12910536Nrq8a_mnoise-induced hearing loss resistant QTL 8a (mouse)175680065690800808Mouse
12910537Nrq8_mnoise-induced hearing loss resistant QTL 8 (mouse)175680065690800808Mouse
4142201Obrq15_mobesity resistance QTL 15 (mouse)Not determined5722744780578347Mouse
4142414Pregq4_mpregnancy QTL 4 (mouse)Not determined175722744793199751Mouse
4141040Hmtb9_mhemostasis and thrombosis rebleeding time 9 (mouse)Not determined5728209491282202Mouse
1301107Scc4_mcolon tumor susceptibility 4 (mouse)Not determined176199358194987271Mouse
11528551Sluc32_msusceptibility to lung cancer 32 (mouse)176199358194987271Mouse
1302017Aliq3_macute lung injury QTL 3 (mouse)Not determined176357811994987271Mouse
1301728Ffal1_mfree fatty acid level 1 (mouse)Not determined176490750994987271Mouse
14928308Manh82_mmandible shape 82 (mouse)176600781494987271Mouse
4142256Nilac12_mnicotine induced locomotor activity 12 (mouse)Not determined176863389194987271Mouse
11039498Ltpr7b_mLeishmania tropica response 7b (mouse)177039377094987271Mouse
11039499Ltpr7a_mLeishmania tropica response 7a (mouse)177039377094987271Mouse
11039500Ltpr7c_mLeishmania tropica response 7c (mouse)177039377094987271Mouse
11039514Ltpr7_mLeishmania tropica response 7 (mouse)177039377094987271Mouse
1301968Estq4_mestradiol regulated response QTL 4 (mouse)Not determined10101150611130694993Mouse
4141402T2dm1sa_mtype 2 diabetes mellitus 1 in SMXA RI mice (mouse)Not determined97922739130694993Mouse
4141007Obrq10_mobesity resistance QTL 10 (mouse)Not determined103407822130694993Mouse
1301895Exq1_mexploratory and excitability QTL 1 (mouse)Not determined10103011947130694993Mouse
1301901Im5_mimmunoregulatory 5 (mouse)Not determined10101661259130694993Mouse
4141487Tgq21_mtriglyceride QTL 21 (mouse)Not determined104274116130694993Mouse
1357544Vtbt10_mvertebral trabecular bone trait 10 (mouse)Not determined1097381196130694993Mouse
1302200Sle12_msystematic lupus erythematosus susceptibility 12 (mouse)Not determined10105205399130694993Mouse
1300678Leg2_mlongevity extending gene 2 (mouse)Not determined10102671003130694993Mouse
1300679Nociq2_mnociceptive sensitivity inflammatory QTL 2 (mouse)Not determined10105205399130694993Mouse
1357744Cfbw4_mcystic fibrosis body weight 4 (mouse)Not determined10101150611130694993Mouse
4141361Cfmq3_mcystic fibrosis modifier QTL 3 (mouse)Not determined10101661259130694993Mouse
4141153Ltgq2_mliver triglyceride QTL 2 (mouse)Not determined108680038130694993Mouse
1357482Nhdlq4_mnon-HDL QTL 4 (mouse)Not determined10105205399130694993Mouse
4142089Obrq9_mobesity resistance QTL 9 (mouse)Not determined108680038130694993Mouse
4142461Bmd25_mbone mineral density 25 (mouse)Not determined1097381196130694993Mouse
11040593Lmr5e_mleishmaniasis resistance 5e (mouse)1099384730130694993Mouse
12911221Frct3d_mfear conditioning traits 3d (mouse)10127839705129631127Mouse
11040595Lmr5c_mleishmaniasis resistance 5c (mouse)1099384730130694993Mouse
12904001Opfaq10_mopen field activity QTL 10 (mouse)10125797802129630506Mouse
11040594Lmr5f_mleishmaniasis resistance 5f (mouse)10105343808130694993Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
12911219Frct3b_mfear conditioning traits 3b (mouse)10127839705129631127Mouse
12880413V125Dq9_mvitamin D active form serum level QTL 9 (mouse)1097700000130694993Mouse
11049563Lmr25a_mleishmaniasis resistance 25a (mouse)10108739225130694993Mouse
11040597Lmr5a_mleishmaniasis resistance 5a (mouse)1099384730130694993Mouse
12911218Frct3a_mfear conditioning traits 3a (mouse)10122950065129631127Mouse
12904000Opfaq7_mopen field activity QTL 7 (mouse)10127910449129630506Mouse
11533921Mvb2_mmodifier of vibrator 2 (mouse)1097381196130694993Mouse
12879490Frct3_mfear conditioning traits 3 (mouse)10122950065129631127Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
14746996Manh69_mmandible shape 69 (mouse)10104927733130694993Mouse
11533919Mvb4_mmodifier of vibrator 4 (mouse)397381196130694993Mouse
14696727Kidrq2_mkidney weight, right QTL 2 (mouse)10103066603130694993Mouse
26884405Huml2_mhumerus length 2, 5 week (mouse)1069900000132500000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
12911220Frct3c_mfear conditioning traits 3c (mouse)10122950065129631127Mouse
11039496Ltpr5b_mLeishmania tropica response 5b (mouse)10108739225130694993Mouse
11049570Lmr25b_mleishmaniasis resistance 25b (mouse)10108739225130694993Mouse
11040596Lmr5d_mleishmaniasis resistance 5d (mouse)10105343808130694993Mouse
11041664Lmr25_mleishmaniasis resistance 25 (mouse)10108739225130694993Mouse
11040598Lmr5b_mleishmaniasis resistance 5b (mouse)10105343808130694993Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100043879 UniSTS
  100534390 UniSTS
  11947 UniSTS
  74355 UniSTS
  751518 UniSTS
UniSTS 262101 UniSTS