Tacr1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Tacr1

Symbol: Tacr1
Also known as: UniSTS:480302; 
RGD ID: 7198805
Expected Size: 207 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38682,403,610 - 82,403,816UniSTSGRCm38
MGSCv37682,353,604 - 82,353,810UniSTSGRCm37
Celera684,385,555 - 84,385,761UniSTS
Cytogenetic Map6D1UniSTS
cM Map6 UniSTS
Is Marker For: Genes:   Tacr1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGGATAACGTCCTTCCTATG
Reverse Primer ATAATTGGTCACTGTCCTCAT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3616606 UniSTS
NCBI Gene 21336 UniSTS
UniSTS 480302 UniSTS