Nfix Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Nfix

Symbol: Nfix
Also known as: UniSTS:474756; 
RGD ID: 7198579
Expected Size: 318 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38884,771,884 - 84,772,201UniSTSGRCm38
MGSCv37887,295,783 - 87,296,100UniSTSGRCm37
Celera889,071,727 - 89,072,044UniSTS
Cytogenetic Map8C1-C2UniSTS
cM Map838.6UniSTS
Is Marker For: Genes:   Nfix  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGTCAAAGGACGAGGAGCGCG
Reverse Primer CGACTTGTAGAGCCGCTCCCCA
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3608603 UniSTS
NCBI Gene 18032 UniSTS
UniGene Mm.9394 UniSTS
UniSTS 474756 UniSTS