Mobp Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Mobp

Symbol: Mobp
Also known as:
RGD ID: 7198501
Expected Size: 303 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389120,149,444 - 120,149,745UniSTSGRCm38
MGSCv379120,058,562 - 120,058,863UniSTSGRCm37
Celera9120,618,259 - 120,618,560UniSTS
Cytogenetic Map9F4UniSTS
Is Marker For: Genes:   Mobp  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGTGTGACGTGCCTTTAGC
Reverse Primer AGCTGGGCGACCTCAGTACACGAG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4418894 UniSTS
NCBI Gene 17433 UniSTS
UniSTS 528065 UniSTS